ID aotvoCD45_D1\(AAM48511)_Fragm\(5') STANDARD;PRT; 262 AA. AC AAM48511; DT 26-JUN-2003 DE CD45 phosphatase [Aotus vociferans]. OS Aotus vociferans. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Platyrrhini; Cebidae; Aotinae; Aotus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 433) CC GPRFLN| AUTHORS Montoya,G.E., Vernot,J.P. and Patarroyo,M.E. CC GPRFLN| TITLE Partial characterization of the CD45 phosphatase cDNA in the owl CC GPRFLN| monkey Aotus vociferans CC GPRFLN| JOURNAL Unpublished CC GPRFLN|REFERENCE 2 (residues 1 to 433) CC GPRFLN| AUTHORS Montoya,G.E., Vernot,J.P. and Patarroyo,M.E. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (26-MAR-2001) Fisiologia Molecular, FIDIC, Avenida El CC GPRFLN| Dorado, Carrera 50. INEA, Bogota, DC, Colombia CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302453282| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 262 VNTIFKEY:269 FT PROTEIN 1 262 VNTIFKEY:270 SQ SEQUENCE 262 AA; DILLETYKRK IADEGRLFLA EFQSIPRVFS KFPIKEARKP FNQNKNRYVD ILPYDYNRVE 60 LSEINGDAGS NYINASYIDG FKEPRKYIAA QGPRDETVDD FWRMIWEQKA TVIVMVTRCE 120 EGNRNKCAEY WPSVEEGTRA FGDVVVKINQ HKRCPDYIIQ KLNIINKKEK TAGREVTHIQ 180 FTSWPDHGVP EDPHLLLKLR RRVNAFSNFF XGPIVVHCSA GVGRTGTYIG IDAMLEGLEA 240 ENKVDVYGYV DKLRRQRCLM VQ 262 // ID aotvoCD45_D2\(AAM48512)\(3') STANDARD;PRT; 300 AA. AC AAM48512; DT 17-MAY-2003 DE CD45 phosphatase [Aotus vociferans]. OS Aotus vociferans. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Platyrrhini; Cebidae; Aotinae; Aotus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 365) CC GPRFLN| AUTHORS Montoya,G.E., Vernot,J.P. and Patarroyo,M.E. CC GPRFLN| TITLE Partial characterization of the CD45 phosphatase cDNA in the owl CC GPRFLN| monkey Aotus vociferans CC GPRFLN| JOURNAL Unpublished CC GPRFLN|REFERENCE 2 (residues 1 to 365) CC GPRFLN| AUTHORS Montoya,G.E., Vernot,J.P. and Patarroyo,M.E. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (26-MAR-2001) Fisiologia Molecular, FIDIC, Avenida El CC GPRFLN| Dorado, Carrera 50. INEA, Bogota, DC, Colombia CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302453330| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 300 VNTIFKEY:269 FT PROTEIN 1 300 VNTIFKEY:270 SQ SEQUENCE 300 AA; NMKKRDPPSE PSPLEAEFQR LPSYRSWRTQ HIGNQEENKS KNRNSNVIPY DFNRVPLKHE 60 LEMSKESEHD SDESSDDDSD SEEXSKYINA SFIMXXWKPE VMIAAQGPLX ETIGDFWQMI 120 FQRKVKVIVM LTELKHGDQE ICAQYWGEGK QTYGDIEVDL KDTDKSSTYT LRVFELRHSK 180 RKDSRTVYQY QYTNWSVXXL PAXPKELISM IQVXKQKLPQ KNSSEGNKXH KSXPLLIHCR 240 DGSQQTGIFC ALLNLLESAE TEEVVDXFQV VKALRKARPG MXSTFEQXQF LYDXIASTYP 300 // ID bIA2_D1\(P56722)\PTPRN STANDARD;PRT; 279 AA. AC P56722; DT 17-MAY-2003 DE Protein-tyrosine phosphatase-like N precursor (R-PTP-N) (Islet cell autoantigen 512) (ICA512). KW Receptor; Glycoprotein; Signal; Transmembrane. OS Bos taurus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Cetartiodactyla; Ruminantia; Pecora; Bovoidea; Bovidae; Bovinae; Bos. CC ------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a CC collaboration between the Swiss Institute of Bioinformatics and CC the EMBL outstation - the European Bioinformatics Institute. CC The original entry is available from http://www.expasy.ch/sprot CC and http://www.ebi.ac.uk/sprot CC ------------------------------------------------------------------. CC [FUNCTION] Implicated in neuroendocrine secretory processes. May be CC involved in processes specific for neurosecretory granules, such as CC their biogenesis, trafficking or regulated exocytosis or may have a CC general role in neuroendocrine functions. Lacks intrinsic enzyme CC activity. May play a role in the regulation of secretory granules CC via its interaction with SNTB2 (By similarity). CC [SUBUNIT] Interacts with phosphorylated SNTB2, protecting it from CC protein cleavage by CAPN1. Dephosphorylation of SNTB2 upon insulin CC stimulation disrupts the interaction and results in its cleavage CC (By similarity). CC [SUBCELLULAR LOCATION] Type I membrane protein. Neuroendocrine CC secretory granules. CC [PTM] N-glycosylated. CC [SIMILARITY] CONTAINS 1 PROTEIN-TYROSINE PHOSPHATASE DOMAIN. CC GPRFLN|REFERENCE 1 (residues 1 to 979) CC GPRFLN| AUTHORS Hermel,J.-M., Dirkx,R. and Solimena,M. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (~JUN-1999) CC GPRFLN| REMARK SEQUENCE FROM N.A. CC GPRFLN|REFERENCE 2 (residues 1 to 979) CC GPRFLN| AUTHORS Hermel,J.M., Dirkx,R. Jr. and Solimena,M. CC GPRFLN| TITLE Post-translational modifications of ICA512, a receptor tyrosine CC GPRFLN| phosphatase-like protein of secretory granules CC GPRFLN| JOURNAL Eur. J. Neurosci. 11 (8), 2609-2620 (1999) CC GPRFLN| MEDLINE 99388259 CC GPRFLN| REMARK SEQUENCE OF N-TERMINUS, AND CHARACTERIZATION. CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302454273| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT CHAIN 1 279 PROTEIN-TYROSINE PHOSPHATASE-LIKE N. FT VNTIFKEY:203; VNTINAME:PTPRN FT DOMAIN 1 279 CYTOPLASMIC (POTENTIAL). FT VNTIFKEY:1004; VNTINAME:PTPRN FT DOMAIN 4 279 PROTEIN-TYROSINE PHOSPHATASE-LIKE. FT VNTIFKEY:1000; VNTINAME:PTPRN FT ACT_SITE 217 217 BY SIMILARITY. FT VNTIFKEY:220; VNTINAME:PTPRN SQ SEQUENCE 279 AA; HMILAYMEDH LRNRDRLAKE WQALCAYQAE PNTCATAQGE GNIKKNRHPD FLPYDHARIK 60 LKVESSPSRS DYINASPIIE HDPRMPAYIA TQGPLSHTIA DFWQMVWESG CTVIVMLTPL 120 VEDGVKQCDR YWPDEGSSLY HVYEVNLVSE HIWCEDFLVR SFYLKNVQTQ ETRTLTQFHF 180 LSWPAEGTPA STRPLLDFRR KVNKCYRGRS CPIIVHCSDG AGRTGTYILI DMVLNRMAKG 240 VKEIDIAATL EHVRDQRPGL VRSKDQFEFA LTAVAEEVN 279 // ID bPTPBA14_D1\(NP_777015)\PTPN13 STANDARD;PRT; 275 AA. AC NP_777015; DT 2-JUL-2003 DE protein tyrosine phosphatase, non-receptor type 13 [APO-1/CD95 (Fas)-associated phosphatase] [Bos taurus]. OS Bos taurus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Cetartiodactyla; Ruminantia; Pecora; Bovoidea; Bovidae; Bovinae; Bos. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from U20807.1. CC GPRFLN|REFERENCE 1 (residues 1 to 2484) CC GPRFLN| AUTHORS Vega,Q.C., Walton,K.M. and Dixon,J.E. CC GPRFLN| TITLE Tyrosine Phosphatases and the Cytoskeleton CC GPRFLN| JOURNAL Unpublished CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|307067825| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 VNTIFKEY:270 FT REGION 20 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 275 AA; AKLKSVIRML RGLLDQGIPS KELENLQELK PLDQCLIGQT KENRRKNRYK NILPYDATRV 60 PLGDEGGYIN ASFIKIPVGR EEFVYIACQG PLPTTVGDFW QMIWEQNSSV IAMMTQEVEG 120 EKIKCQRYWP NVLGKSTMVS NRLRLALVRV QQLKGFVVRA MTLEDIQTGE VRHVSHLNFT 180 AWPDHDTPSQ PDDLLTFISY MRHVHRSGPI ITHCSAGIGR SGTLICIDVV LGLISQDLEF 240 DISDLVRCMR LQRHGMVQTE DQYIFCYQVI LYVLT 275 // ID cCD45_D1\(A54080) STANDARD; PRT; 279 AA. AC A54080; DT 17-MAY-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48), receptor type delta precursor - chicken. KW phosphoprotein; phosphoric monoester hydrolase; tyrosine-specific phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC GPRFLN|REFERENCE 1 (residues 1 to 1237) CC GPRFLN| AUTHORS Fang,K.S., Barker,K., Sudol,M. and Hanafusa,H. CC GPRFLN| TITLE A transmembrane protein-tyrosine phosphatase contains spectrin-like CC GPRFLN| repeats in its extracellular domain CC GPRFLN| JOURNAL J. Biol. Chem. 269 (19), 14056-14063 (1994) CC GPRFLN| MEDLINE 94245724 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302463475| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT DOMAIN 1 279 leukocyte common antigen cytosolic domain homology #label LAC FT VNTIFKEY:1000; VNTINAME:LAC FT DOMAIN 42 266 protein-tyrosine-phosphatase homology #label PTP FT VNTIFKEY:1000; VNTINAME:PTP FT ACT_SITE 218 218 Cys (phosphocysteine intermediate) FT VNTIFKEY:220; VNTINAME:Active_Site_1 FT BINDING 224 224 substrate phosphate (Arg) FT VNTIFKEY:1007; VNTINAME:Binding_1 SQ SEQUENCE 279 AA; EKLLETYKRK IADEGRLFLD EFQSIPRIFT KFPMKEAKRS HNQNKNRYID ILPYDHNRVE 60 LSEIPGDPGS DYINASYIDG FKEPRKYIAA QGPKDETTDD FWRMIWEQKA TIIVMVTRCE 120 EGNRNKCAQY GPSMENGSAT YGDITVKINE SKICPDYIIQ KLHITNGRER TSGRDVTHIQ 180 FTSWPDHGVP EDPHLLLKLR RRVNALSNFF SGPIVVHCSA GVGRTGTYIG IDAMLEGLDA 240 EGRVDVYGYV VKLRRQRCLM VQVESQYILI HQALVEYHQ 279 // ID cCD45_D2\(A54080) STANDARD; PRT; 308 AA. AC A54080; DT 17-MAY-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48), receptor type delta precursor - chicken. KW phosphoprotein; phosphoric monoester hydrolase; tyrosine-specific phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC GPRFLN|REFERENCE 1 (residues 1 to 1237) CC GPRFLN| AUTHORS Fang,K.S., Barker,K., Sudol,M. and Hanafusa,H. CC GPRFLN| TITLE A transmembrane protein-tyrosine phosphatase contains spectrin-like CC GPRFLN| repeats in its extracellular domain CC GPRFLN| JOURNAL J. Biol. Chem. 269 (19), 14056-14063 (1994) CC GPRFLN| MEDLINE 94245724 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464996| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 308 VNTIFKEY:269 FT PROTEIN 1 308 VNTIFKEY:270 FT DOMAIN 1 308 leukocyte common antigen cytosolic domain homology #label LAC FT VNTIFKEY:1000; VNTINAME:LAC SQ SEQUENCE 308 AA; SELHSYLNNL KRKDPPSEPS LLEAKFQRLP SYKGWRTQNT GNREENKNKN RSANTIPYDF 60 NRVPIRSEEE QSKEGEHDSE DSSDEDSDCE ESSRYINASF ITGYWGPKAM IATQGPLQET 120 ISDFWQMVFQ RKVKVIVMLT ELKEGDQELC AQYWGEGRQT YDDIEVQVTD VNCCPSYTIR 180 AFDVTHLKRK ETQKVYQYQY HKWNGLDVPE DPKDLVDMIL SLKQKVPSRP ASEDSRNSRS 240 VPFVIHCCDG SQQTWCVLCL MTLLESAETE EVIDVFQVVK ALRRSRLGVV STFEQYQFLY 300 DTIARTYP 308 // ID cDEP1_D1\(CAB41885) STANDARD; PRT; 277 AA. AC CAB41885; DT 27-JUN-2003 DE supporting-cell antigen [Gallus gallus]. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC On Jun 28, 2001 this sequence version replaced gi:4741401. CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Kruger,R.P., Goodyear,R.J., Legan,P.K., Warchol,M.E., Raphael,Y., CC GPRFLN| Cotanche,D.A. and Richardson,G.P. CC GPRFLN| TITLE The supporting-cell antigen: a receptor-like protein tyrosine CC GPRFLN| phosphatase expressed in the sensory epithelia of the avian inner CC GPRFLN| ear CC GPRFLN| JOURNAL J. Neurosci. 19 (12), 4815-4827 (1999) CC GPRFLN| MEDLINE 99296852 CC GPRFLN|REFERENCE 2 CC GPRFLN| AUTHORS Legan,P.K. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (26-APR-1999) Legan P.K., School of Biological Sciences, CC GPRFLN| University of Sussex, Falmer, Brighton, BN1 9QG, UNITED KINGDOM CC GPRFLN| REMARK Revised by [3] CC GPRFLN|REFERENCE 3 (residues 1 to 1406) CC GPRFLN| AUTHORS Legan,P.K. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (27-JUN-2001) Legan P.K., School of Biological Sciences, CC GPRFLN| University of Sussex, Falmer, Brighton, BN1 9QG, UNITED KINGDOM CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302465246| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 277 VNTIFKEY:269 FT PROTEIN 1 277 VNTIFKEY:270 SQ SEQUENCE 277 AA; ENFESYFKKQ QADSNCGFAE EYEELKSAGV HQPKFAAEIA ENRGKNRYNN VLPYDISRVK 60 LSNPSCTTDD YINANYMPGY SSKKAFIAAQ GPLPNTIEDF WRMIWEKNIY SIVMLTKCVE 120 QARTKCEQYW PDKQSKSYGD IIVTMVSEVV LPEWTIRDFN VENADTMESH TVRQFHFTSW 180 PDHGVPETTD LLINFRHLVH EYSSQNPIDS PILVHCSAGV GRTGTFIAID RLIQQIEMEN 240 TVDVYGVVYD LRMHRPLMVQ TEDQYVFLNQ CVMDIIR 277 // ID cGLEPP1_D1\(AAB17968) STANDARD;PRT; 277 AA. AC AAB17968; DT 27-JUN-2003 DE protein tyrosine phosphatase CRYP-2 [Gallus gallus]. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 1267) CC GPRFLN| AUTHORS Bodden,K. and Bixby,J.L. CC GPRFLN| TITLE CRYP-2: a receptor-type tyrosine phosphatase selectively expressed CC GPRFLN| by developing vertebrate neurons CC GPRFLN| JOURNAL J. Neurobiol. 31 (3), 309-324 (1996) CC GPRFLN| MEDLINE 97067376 CC GPRFLN|REFERENCE 2 (residues 1 to 1267) CC GPRFLN| AUTHORS Bodden,K. and Bixby,J.L. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (01-AUG-1996) Pharmacology, University of Miami, 1600 NW CC GPRFLN| 10 Ave, Miami, FL 33136, USA CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302465459| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 276 VNTIFKEY:269 FT PROTEIN 1 276 VNTIFKEY:270 SQ SEQUENCE 277 AA; DDFDGYIKDM AKDSDYKFSL QFEELKLIGL DIPHFAADLP MNRCKNRYTN ILPYDFSRVR 60 LVSMNEEEGS DYINANYIPG YNSPQEYIAT QGPLPETRND FWKMVLQQKS QIIVMLTQCN 120 EKRRVKCDHY WPFTEDPIAY GDITVEMLSE EEHTDWVYRN FRISYADEVQ DVMHFNYTAW 180 PDHGVPTANA AESILQFVQM VRQKSVKSKG PMIIHCSAGV GRTGTFIALD WLLQHIRDHE 240 FVDILGLVSD MRSYRMSMVQ TEEQYIFIHQ CVQLMWQ 277 // ID cMG-PTP1_D1\(AAB33980)_Fragm STANDARD;PRT; 81 AA. AC AAB33980; DT 28-JUN-2003 DE Muller glia protein tyrosine phosphatase 1, MG-PTP1 [chickens, retinas, Muller glia cells, Peptide Partial, 81 aa]. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation supplied by author. CC GPRFLN|REFERENCE 1 (residues 1 to 81) CC GPRFLN| AUTHORS Shock,L.P., Bare,D.J., Klinz,S.G. and Maness,P.F. CC GPRFLN| TITLE Protein tyrosine phosphatases expressed in developing brain and CC GPRFLN| retinal Muller glia CC GPRFLN| JOURNAL Brain Res. Mol. Brain Res. 28 (1), 110-116 (1995) CC GPRFLN| MEDLINE 95223107 CC GPRFLN| REMARK GenBank staff at the National Library of Medicine created this CC GPRFLN| entry [NCBI gibbsq 165661] from the original journal article. CC GPRFLN| This sequence comes from Fig. 2C. CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|0| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 81 VNTIFKEY:269 FT PROTEIN 1 81 MG-PTP1 FT VNTIFKEY:270 SQ SEQUENCE 81 AA; GRGTDTYGMI QVTLLDTIEL ATFCVRTFSL HKNGSSKKRE VRQFQFTAWP DHGVPEYPTP 60 FLAFLRRVKT CNPPDAGPIV V 81 // ID cMG-PTP2_D1\(AAB33981)_Fragm STANDARD;PRT; 87 AA. AC AAB33981; DT 26-JUN-2003 DE Muller glia protein tyrosine phosphatase 2, MG-PTP2 {MG-PTP2 catalytic domain} [chickens, retinas, Muller glia cells, Peptide Partial, 87 aa]. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation supplied by author. CC GPRFLN|REFERENCE 1 (residues 1 to 87) CC GPRFLN| AUTHORS Shock,L.P., Bare,D.J., Klinz,S.G. and Maness,P.F. CC GPRFLN| TITLE Protein tyrosine phosphatases expressed in developing brain and CC GPRFLN| retinal Muller glia CC GPRFLN| JOURNAL Brain Res. Mol. Brain Res. 28 (1), 110-116 (1995) CC GPRFLN| MEDLINE 95223107 CC GPRFLN| REMARK GenBank staff at the National Library of Medicine created this CC GPRFLN| entry [NCBI gibbsq 165663] from the original journal article. CC GPRFLN| This sequence comes from Fig. 2D. CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|0| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 87 VNTIFKEY:269 FT PROTEIN 1 87 MG-PTP2 FT VNTIFKEY:270 SQ SEQUENCE 87 AA; TRGEEVMVFS ETGFRVRLVS EDIKSYYTVH LLQLENINSG ESRMISHFHY TTWPDFGVPE 60 SPASFLNFLF KVRESGCLSP EHGPAVD 87 // ID cPTP-NT1subtype_D1\(AAA49018)_Fragm STANDARD;PRT; 62 AA. AC AAA49018; DT 28-JUN-2003 DE phosphoprotein phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 62) CC GPRFLN| AUTHORS Potts,J.D. CC GPRFLN| TITLE Protein tyrosine phosphatases isolated from embryonic chicken lens CC GPRFLN| epithelium CC GPRFLN| JOURNAL Unpublished (1993) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306551667| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|UNKNOWN| FT SOURCE 1 62 VNTIFKEY:269 FT PROTEIN 1 62 VNTIFKEY:270 SQ SEQUENCE 62 AA; GSDYINASLI KMEEAQRSYI LTQGPLPNTC GHFWEMVWEQ KSRGVVMLNR VMEKGSIKCD 60 QY 62 // ID cPTP-NT1subtype_D1\(AAA49019)_Fragm STANDARD;PRT; 63 AA. AC AAA49019; DT 26-JUN-2003 DE phosphoprotein phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 63) CC GPRFLN| AUTHORS Potts,J.D. CC GPRFLN| TITLE Protein tyrosine phosphatases isolated from embryonic chicken lens CC GPRFLN| epithelium CC GPRFLN| JOURNAL Unpublished (1993) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|0| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 63 VNTIFKEY:269 FT PROTEIN 1 63 VNTIFKEY:270 SQ SEQUENCE 63 AA; GSDYINASLV VIEEAQRYYI LTQGPLPNTC CHFWLMVWQQ QTKAVVMLNR IVEKDSVKCA 60 QYW 63 // ID cPTP-R2Asubtype_D1\(AAA49017)_Fragm STANDARD;PRT; 63 AA. AC AAA49017; DT 28-JUN-2003 DE phosphoprotein phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 63) CC GPRFLN| AUTHORS Potts,J.D. CC GPRFLN| TITLE Protein tyrosine phosphatases isolated from embryonic chicken lens CC GPRFLN| epithelium CC GPRFLN| JOURNAL Unpublished (1993) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|0| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 63 VNTIFKEY:269 FT PROTEIN 1 63 VNTIFKEY:270 SQ SEQUENCE 63 AA; GSDYINASSI DGYRQQKAYI ATQGPLAETT EDFWWMLWEN NSTIVVMLTK LREMGREKCA 60 QYW 63 // ID cPTP-R2Bsubtype_D1\(AAA49016)_Fragm STANDARD;PRT; 63 AA. AC AAA49016; DT 26-JUN-2003 DE phosphoprotein phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 63) CC GPRFLN| AUTHORS Potts,J.D. CC GPRFLN| TITLE Protein tyrosine phosphatases isolated from embryonic chicken lens CC GPRFLN| epithelium CC GPRFLN| JOURNAL Unpublished (1993) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|0| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 63 VNTIFKEY:269 FT PROTEIN 1 63 VNTIFKEY:270 SQ SEQUENCE 63 AA; GSDYMNANYI DGYHRSNHFI ATQGPKQEMV YDFWRMVWQE HCSSIVMITK LVEVGRVKCA 60 QYW 63 // ID cPTP1B_D1\(O13016) STANDARD; PRT; 279 AA. AC O13016; DT 17-MAY-2003 DE Protein-tyrosine phosphatase, non-receptor type 1 (Protein-tyrosine phosphatase 1B) (PTP-1B) (CPTP1). KW Hydrolase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC ------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a CC collaboration between the Swiss Institute of Bioinformatics and CC the EMBL outstation - the European Bioinformatics Institute. CC The original entry is available from http://www.expasy.ch/sprot CC and http://www.ebi.ac.uk/sprot CC ------------------------------------------------------------------. CC [CATALYTIC ACTIVITY] PROTEIN TYROSINE PHOSPHATE + H(2)O = PROTEIN CC TYROSINE + ORTHOPHOSPHATE. CC [SUBCELLULAR LOCATION] ASSOCIATED TO THE ENDOPLASMIC RETICULUM VIA CC ITS C-TERMINAL DOMAIN WITH ITS PHOSPHATASE DOMAIN ORIENTED TOWARDS CC THE CYTOPLASM (BY SIMILARITY). CC [SIMILARITY] BELONGS TO THE NON-RECEPTOR CLASS OF THE CC PROTEIN-TYROSINE PHOSPHATASE FAMILY. CC GPRFLN|REFERENCE 1 (residues 1 to 434) CC GPRFLN| AUTHORS Balsamo,J., Leung,T., Ernst,H., Zanin,M.K., Hoffman,S. and CC GPRFLN| Lilien,J. CC GPRFLN| TITLE Regulated binding of PTP1B-like phosphatase to N-cadherin: control CC GPRFLN| of cadherin-mediated adhesion by dephosphorylation of beta-catenin CC GPRFLN| JOURNAL J. Cell Biol. 134 (3), 801-813 (1996) CC GPRFLN| MEDLINE 96326683 CC GPRFLN| REMARK SEQUENCE FROM N.A. CC GPRFLN| TISSUE=Retina CC GPRFLN|REFERENCE 2 (residues 1 to 434) CC GPRFLN| AUTHORS Kim,C.W., Jung,E.J. and Kang,Y.-S. CC GPRFLN| TITLE Cloning and characterization of a chicken protein tyrosine CC GPRFLN| phosphatase, CPTP1 CC GPRFLN| JOURNAL Exp. Mol. Med. 28, 207-213 (1996) CC GPRFLN| REMARK SEQUENCE OF 14-369 FROM N.A. CC GPRFLN| TISSUE=Intestine CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464650| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT CONFLICT ? ? A -> R (IN REF. 2). FT VNTIFKEY:240; VNTINAME:PTPN1 FT DOMAIN 40 279 PROTEIN-TYROSINE PHOSPHATASE. FT VNTIFKEY:1000; VNTINAME:PTPN1 FT CONFLICT 62 63 GD -> RC (IN REF. 2). FT VNTIFKEY:240; VNTINAME:PTPN1 FT ACT_SITE ? ? VNTIFKEY:220; VNTINAME:PTPN1 SQ SEQUENCE 279 AA; MEIEKEFHRL DQAASWAAIY QDIRHEASDF PCKVAKHPRN KNRNRYRDVS PFDHSRIKLN 60 QGDNDYINAS LIKMEEAQRS YILTQGPLPN TCGHFWEMVW EQKSRGVVML NRVMEKGSIK 120 CAQYWPRKEE KEMFFEDTNL KLTLISEDIK SYYTVRQLEL ENLTTQETRE ILHFHYTTWP 180 DFGVPESPAS FLNFLFKVRE SGSLNPEYGP VVVHCSAGIG RSGTFCLVDT CLLLMDKRKD 240 PSSVDVKQVL LEMRKYRMGL IQTADQLRFS YLAVIEGAK 279 // ID cPTPalpha_D1\(AAB04150) STANDARD;PRT; 280 AA. AC AAB04150; DT 17-MAY-2003 DE protein tyrosine phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 807) CC GPRFLN| AUTHORS Fang,K.S. CC GPRFLN| TITLE Structural and functional characterization of two chicken tyrosine CC GPRFLN| phosphatases CC GPRFLN| JOURNAL Thesis (1993) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302463254| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 280 VNTIFKEY:269 FT PROTEIN 1 280 VNTIFKEY:270 FT CHAIN 1 280 VNTIFKEY:203; VNTINAME:Chain_1 SQ SEQUENCE 280 AA; DKLEEEINRR IGDDNKLFRE EFNALPACPI QATCEAASKE ENKEKNRYVN ILPYDHSRVH 60 LTPVEGVPDS HYINTSFINS YQEKNKFIAA QGPKEETVND FWRMIWEQNT ATIVMVTNLK 120 ERKECKCAQY WPDQGCWTYG NIRVSVEDVT VLVDYTVRKF CIQQVGDVTN KKPQRLVTQF 180 HFTSWPDFGV PFTPIGMLKF LKKVKTCNPQ YAGAIVVHCS AGVGRTGTFI VIDAMLDMMH 240 AERKVDVYGF VSRIRAQRCQ MVQTDMQYVF IYQALLEHYL 280 // ID cPTPalpha_D2\(AAB04150) STANDARD;PRT; 281 AA. AC AAB04150; DT 17-MAY-2003 DE protein tyrosine phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 807) CC GPRFLN| AUTHORS Fang,K.S. CC GPRFLN| TITLE Structural and functional characterization of two chicken tyrosine CC GPRFLN| phosphatases CC GPRFLN| JOURNAL Thesis (1993) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464946| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 281 VNTIFKEY:269 FT PROTEIN 1 281 VNTIFKEY:270 FT CHAIN 1 281 VNTIFKEY:203; VNTINAME:Chain_1 SQ SEQUENCE 281 AA; TSLEIHLQKI YNKVPGTSSN GLEEEFKKLT SIKIQNDKMR TGNLPANMKK NRVLQIIPYE 60 FNRVIIPVKR GEENTDYVNA SFIDGYRRRT PTCQPRPVQH TIEDFWRMIW EWKSCSIVML 120 TELEERGQEK CAQYWPSDGS VSYGDINVEL KKEEECESYT VRDLLVTNTR ENKSRQIRQF 180 HFHGWPEVGI PSDGKGMINI IAAVQKQQQQ SGNHPMHCHC SAGAGRTGTF CALSTVLERV 240 KAEGILDVFQ TVKSLRLQRP HMVQTLEQYE FCYKVVQEYI D 281 // ID cPTPgamma_D1\(Q98936) STANDARD;PRT; 291 AA. AC Q98936; DT 17-MAY-2003 DE Protein-tyrosine phosphatase gamma precursor (R-PTP-gamma). KW Glycoprotein; Transmembrane; Hydrolase; Repeat; Signal. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC ------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a CC collaboration between the Swiss Institute of Bioinformatics and CC the EMBL outstation - the European Bioinformatics Institute. CC The original entry is available from http://www.expasy.ch/sprot CC and http://www.ebi.ac.uk/sprot CC ------------------------------------------------------------------. CC [CATALYTIC ACTIVITY] Protein tyrosine phosphate + H(2)O = protein CC tyrosine + phosphate. CC [SUBCELLULAR LOCATION] Type I membrane protein (Probable). CC [SIMILARITY] IN THE N-TERMINAL SECTION; BELONGS TO THE CC EUKARYOTIC-TYPE CARBONIC ANHYDRASE FAMILY. CC [SIMILARITY] CONTAINS 2 PROTEIN-TYROSINE PHOSPHATASE DOMAINS. CC [SIMILARITY] CONTAINS 1 FIBRONECTIN TYPE III-LIKE DOMAIN. CC GPRFLN|REFERENCE 1 (residues 1 to 1422) CC GPRFLN| AUTHORS Qinghua,X., Xiaojun,G., Cong,S., Zong,S.M., Jong,Y.J., Chan,J. and CC GPRFLN| Wang,L.-H. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (~OCT-1995) CC GPRFLN| REMARK SEQUENCE FROM N.A. CC GPRFLN| TISSUE=Brain, and Kidney CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464404| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 291 VNTIFKEY:269 FT PROTEIN 1 291 VNTIFKEY:270 FT CHAIN 1 291 PROTEIN-TYROSINE PHOSPHATASE GAMMA. FT VNTIFKEY:203; VNTINAME:PTPRG FT DOMAIN 1 291 CYTOPLASMIC (POTENTIAL). FT VNTIFKEY:1004; VNTINAME:PTPRG FT DOMAIN 39 291 PROTEIN-TYROSINE PHOSPHATASE 1. FT VNTIFKEY:1000; VNTINAME:PTPRG FT ACT_SITE 230 230 BY SIMILARITY. FT VNTIFKEY:220; VNTINAME:PTPRG SQ SEQUENCE 291 AA; KQFVKHISEL YSNNQHGFSE DFEEVQRCTA DMNITAEHSN HPDNKHKNRY INILAYDHSR 60 VKLRPLPGKD SKHSDYINAN YVSGYNKAKA YIATQGPLKS TFEDFWRMIW AQHTGIIVMI 120 TNLVEKGRRK CDQYWPTENS EEYGNIIVTL KSTNIHACYT VRPLHGQEHK DEKGSERKPK 180 GRQNERTVIQ YHYTQWPDMG VPEYALPVLT FVRRSSAART PHMGPVVVHC SAGVGRTGTY 240 IVIDSMLQQI KDKSTVNVLG FLKHIRTQRN YLVQTEEQYI FIHDALLEAI L 291 // ID cPTPgamma_D2\(Q98936) STANDARD;PRT; 283 AA. AC Q98936; DT 27-JUN-2003 DE Protein-tyrosine phosphatase gamma precursor (R-PTP-gamma). KW Glycoprotein; Transmembrane; Hydrolase; Repeat; Signal. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC ------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a CC collaboration between the Swiss Institute of Bioinformatics and CC the EMBL outstation - the European Bioinformatics Institute. CC The original entry is available from http://www.expasy.ch/sprot CC and http://www.ebi.ac.uk/sprot CC ------------------------------------------------------------------. CC [CATALYTIC ACTIVITY] Protein tyrosine phosphate + H(2)O = protein CC tyrosine + phosphate. CC [SUBCELLULAR LOCATION] Type I membrane protein (Probable). CC [SIMILARITY] IN THE N-TERMINAL SECTION; BELONGS TO THE CC EUKARYOTIC-TYPE CARBONIC ANHYDRASE FAMILY. CC [SIMILARITY] CONTAINS 2 PROTEIN-TYROSINE PHOSPHATASE DOMAINS. CC [SIMILARITY] CONTAINS 1 FIBRONECTIN TYPE III-LIKE DOMAIN. CC GPRFLN|REFERENCE 1 (residues 1 to 1422) CC GPRFLN| AUTHORS Qinghua,X., Xiaojun,G., Cong,S., Zong,S.M., Jong,Y.J., Chan,J. and CC GPRFLN| Wang,L.-H. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (~OCT-1995) CC GPRFLN| REMARK SEQUENCE FROM N.A. CC GPRFLN| TISSUE=Brain, and Kidney CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464892| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 VNTIFKEY:270 FT CHAIN 1 283 PROTEIN-TYROSINE PHOSPHATASE GAMMA. FT VNTIFKEY:203; VNTINAME:PTPRG FT DOMAIN 1 283 CYTOPLASMIC (POTENTIAL). FT VNTIFKEY:1004; VNTINAME:PTPRG FT DOMAIN 1 283 PROTEIN-TYROSINE PHOSPHATASE 2. FT VNTIFKEY:1000; VNTINAME:PTPRG FT SITE 222 222 ANCESTRAL ACTIVE SITE. FT VNTIFKEY:265; VNTINAME:PTPRG SQ SEQUENCE 283 AA; NQLHSYVNSI LIPGIGGKTR LEKQFKLVTQ CNAKYVECFS AQKDCNKEKN RNSSVVPSER 60 ARVGLAPLPG MKGTDYINAS YIMGYYRSNE NVITQHPLPH TTKDFWRMIW DHNAQIIVML 120 PDNQSLAEDE FVYWPSREES MNCEAFTVTL ISKDRLCLSN EEQIIIHDFI LEATQDDYVL 180 EVRHFQCPKW PNPDAPISST FELINVIKEE ALTRDGPTIV HDEYGAVSAG TLCALTTLSQ 240 QLENENAVDV FQVAKMINLM RPGVFTDIEQ YQFLYKAMLS LVS 283 // ID cPTPsigma_D1\(I50212) STANDARD;PRT; 275 AA. AC I50212; DT 17-MAY-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48) - chicken. KW phosphoprotein; phosphoric monoester hydrolase; tyrosine-specific phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC GPRFLN|REFERENCE 1 (residues 1 to 1499) CC GPRFLN| AUTHORS Stoker,A.W. CC GPRFLN| TITLE Isoforms of a novel cell adhesion molecule-like protein tyrosine CC GPRFLN| phosphatase are implicated in neural development CC GPRFLN| JOURNAL Mech. Dev. 46 (3), 201-217 (1994) CC GPRFLN| MEDLINE 95001563 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302465303| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 VNTIFKEY:270 FT DOMAIN 1 275 leukocyte common antigen cytosolic domain homology #label LAC FT VNTIFKEY:1000; VNTINAME:LAC FT ACT_SITE 214 214 Cys (phosphocysteine intermediate) FT VNTIFKEY:220; VNTINAME:Active_Site_1 FT BINDING 220 220 substrate phosphate (Arg) FT VNTIFKEY:1007; VNTINAME:Binding_1 SQ SEQUENCE 275 AA; SELAEHTEHL KANDNLKLSQ EYESIDPGQQ FTWEHSNLEV NKPKNRYANV IAYDHSRVIL 60 LPIEGIVGSD YINANYIDGY RKQNAYIATQ GPLPETFGDF WRMVWEQRSA TIVMMTKLEE 120 KSRIKCDQYW PGRGTDTYGM IQVTLLDTIE LATFCVRTFS LHKNGSSEKR EVRQFQFTAW 180 PDHGVPEYPT PFLAFLRRVK TCNPPDAGPI VVHCSAGVGR TGCFIVIDAM LERIKHEKTV 240 DIYGHVTLMR SQRNYMVQTE DQYSFIHDAL LEAVA 275 // ID cPTPsigma_D2\(I50212) STANDARD;PRT; 282 AA. AC I50212; DT 27-JUN-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48) - chicken. KW phosphoprotein; phosphoric monoester hydrolase; tyrosine-specific phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC GPRFLN|REFERENCE 1 (residues 1 to 1499) CC GPRFLN| AUTHORS Stoker,A.W. CC GPRFLN| TITLE Isoforms of a novel cell adhesion molecule-like protein tyrosine CC GPRFLN| phosphatase are implicated in neural development CC GPRFLN| JOURNAL Mech. Dev. 46 (3), 201-217 (1994) CC GPRFLN| MEDLINE 95001563 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302465404| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 282 VNTIFKEY:269 FT PROTEIN 1 282 VNTIFKEY:270 FT DOMAIN 1 282 leukocyte common antigen cytosolic domain homology #label LAC FT VNTIFKEY:1000; VNTINAME:LAC FT DOMAIN 47 269 protein-tyrosine-phosphatase homology #label PTP2 FT VNTIFKEY:1000; VNTINAME:PTP2 FT ACT_SITE 222 222 Cys (phosphocysteine intermediate) FT VNTIFKEY:220; VNTINAME:Active_Site_2 FT BINDING 228 228 substrate phosphate (Arg) FT VNTIFKEY:1007; VNTINAME:Binding_2 SQ SEQUENCE 282 AA; RNLYTYIQKL AQIEVGEHVT GMELEFKRLA NSKAHTSRFI SANLPCNKFK NRLVNIMPYE 60 TTRVCLQPIR GVEGSDYINA SFIDGYRQQK AYIATQGPLA ETTEDFWRML WENNSTIVVM 120 LTKLREMGRE KCHQYWPAER SARYQYFVVD PMAEYNMPQY ILREFKVTDA RDGQSRTVRQ 180 FQFTDWPEQG VPKSGEGFID FIGQVHKTKE QFGQDGPISV HCSAGVGRTG VFITLSIVLE 240 RMRYEGVVDI FQTVKMLRTQ PAMVQTEDEY QFCYQAALEY LG 282 // ID cPTPzeta_D1\(AAA49015) STANDARD;PRT; 286 AA. AC AAA49015; DT 17-MAY-2003 DE phosphotyrosyl phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 832) CC GPRFLN| AUTHORS Rowley,R.B., Lee,J.M., Corbeil,H.B., Charbonneau,R., Jue,K., CC GPRFLN| Dankort,D.L. and Branton,P.E. CC GPRFLN| TITLE Isolation of chicken phosphotyrosyl phosphatase cDNA sequences and CC GPRFLN| identification of a brain-specific species related to human PTP CC GPRFLN| zeta CC GPRFLN| JOURNAL Cell. Mol. Biol. Res. 39 (3), 209-219 (1993) CC GPRFLN| MEDLINE 94122757 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464518| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 286 VNTIFKEY:269 FT PROTEIN 1 286 VNTIFKEY:270 SQ SEQUENCE 286 AA; KHFPKHVADL HASNGFSEEF EEIQSCTVDL GITSDSSNHP DNKNKNRYIN IVAYDHTRVK 60 LAQLAEKDGK LTDYINANYV DGYNKPKAYI AAQGPLKSTA EDFWRMIWEH NVEVIVMITN 120 LLEKGRRKCD QYWPAEGSEE YGNFLVTQKS VHVLAYYTVR NFTLRNTKIK KGSQKGRSSG 180 RVVTQYHYTQ WPDMGVPEYT LPVLTFVRKA SHAKRHAVGP IVVHCSAGVG RTGTYVVLDS 240 MLQQIQHEGT VNIFGFLKHI RTQRNYLVQT EEQYIFIHDA LVEAIL 286 // ID cPTPzeta_D2\(AAA49015) STANDARD;PRT; 282 AA. AC AAA49015; DT 27-JUN-2003 DE phosphotyrosyl phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 832) CC GPRFLN| AUTHORS Rowley,R.B., Lee,J.M., Corbeil,H.B., Charbonneau,R., Jue,K., CC GPRFLN| Dankort,D.L. and Branton,P.E. CC GPRFLN| TITLE Isolation of chicken phosphotyrosyl phosphatase cDNA sequences and CC GPRFLN| identification of a brain-specific species related to human PTP CC GPRFLN| zeta CC GPRFLN| JOURNAL Cell. Mol. Biol. Res. 39 (3), 209-219 (1993) CC GPRFLN| MEDLINE 94122757 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464822| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 282 VNTIFKEY:269 FT PROTEIN 1 282 VNTIFKEY:270 SQ SEQUENCE 282 AA; THIHAYVNAL LIPGPTGKTR LEKQFKLLSQ SNTQQCDYST ALKQCNREKN RTSSIIPVER 60 SRVGISSLSG EGTDYINASY IMGYYQSNEF IITQHPLLHT IKDFWRMIWD HNAQLIVMLP 120 DSQNMAEDEF VYWPNKDEPI NCETFKVTMI AEEHKCLSKE EKLIIQDFIL EATQDDYVLE 180 VRHFQCPKWP NPDSPISKTF ELISIIKEET SNRDGPMIVH DEHGGVTAGT FCALTTLMHQ 240 LENENSVDVY QVAKMINLMR PGVFTDIEQY QFLYKAILSL VS 282 // ID cSHP2_D1\(JC5167) STANDARD; PRT; 300 AA. AC JC5167; DT 17-MAY-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48), nonreceptor type 11 - chicken. KW phosphoprotein; phosphoric monoester hydrolase; tyrosine-specific phosphatase. OS Gallus gallus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archosauria; Aves; Neognathae; Galliformes; Phasianidae; Phasianinae; Gallus. CC This enzyme plays positive roles in mitogenic signaling and early CC development. CC GPRFLN|REFERENCE 1 (residues 1 to 593) CC GPRFLN| AUTHORS Park,C.Y., LaMontagne,K.R., Tonks,N.K. and Hayman,M.J. CC GPRFLN| TITLE Cloning and expression of the chicken protein tyrosine phosphatase CC GPRFLN| SH-PTP2 CC GPRFLN| JOURNAL Gene 177 (1-2), 93-97 (1996) CC GPRFLN| MEDLINE 97080506 CC GPRFLN| REMARK erythroblast CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302464602| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 300 VNTIFKEY:269 FT PROTEIN 1 300 phosphotyrosine phosphatase; PTP1D; PTP2c; SH-PTP2; SyP FT VNTIFKEY:270 FT DOMAIN 50 287 protein-tyrosine-phosphatase homology #label PTP FT VNTIFKEY:1000; VNTINAME:PTP FT ACT_SITE 236 236 Cys (phosphocysteine intermediate) FT VNTIFKEY:220; VNTINAME:Active_Site_1 FT BINDING 242 242 substrate phosphate (Arg) FT VNTIFKEY:1007; VNTINAME:Binding_1 SQ SEQUENCE 300 AA; AEIESRVREL SKLAETTDKV KQGFWEEFET LQQQECKLLY SRKEGQRQEN KNKNRYKNIL 60 PFDHTRVVLH DGDPNEPVSD YINANIIMPE FETKCNNSKP KKSYIATQGC LQNTVNDFWR 120 MVFQENSRVI VMTTKEVERG KSKCVKYWPD EYSLKEYGVM RVRNVKESAA HDYTLRELKL 180 SKVGQGNTER TVWQYHFRTW PDHGVPSDPG GVLDFLEEVH HKQESISDAG PVVVHCSAGI 240 GRTGTFIVID ILIDIIREKG VDCDIDVPKT IQMVRSQRSG MVQTEAQYRF IYMAVQHYIE 300 // ID cypcaCD45_D1\(BAA92179) STANDARD;PRT; 276 AA. AC BAA92179; DT 17-MAY-2003 DE CD45 [Cyprinus carpio]. OS Cyprinus carpio. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprinus. CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Fujiki,K., Shin,D.H., Nakao,M. and Yano,T. CC GPRFLN| TITLE Molecular cloning of carp (Cyprinus carpio) leucocyte cell-derived CC GPRFLN| chemotaxin 2, glia maturation factor beta, CD45 and lysozyme C by CC GPRFLN| use of suppression subtractive hybridisation CC GPRFLN| JOURNAL Fish Shellfish Immunol. 10 (7), 643-650 (2000) CC GPRFLN| MEDLINE 20531692 CC GPRFLN|REFERENCE 2 (residues 1 to 1216) CC GPRFLN| AUTHORS Fujiki,K., Nakao,M., Shin,D. and Yano,T. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (24-AUG-1999) Kazuhiro Fujiki, Kyushu University, CC GPRFLN| Laboratory of Marine Biochemistry, Faculty of Agriculture; Hakozaki CC GPRFLN| 6-10-1, Higashi-ku, Fukuoka, Fukuoka 812-8581, Japan CC GPRFLN| (E-mail:fujikik@agr.kyushu-u.ac.jp, Tel:81-92-642-2896, CC GPRFLN| Fax:81-92-642-2894) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302454614| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 276 VNTIFKEY:269 FT PROTEIN 1 276 VNTIFKEY:270 SQ SEQUENCE 276 AA; GGLVEAYKNK IADEGRLFMD EFQSIPRIFS NYTIKEAKKS ENQYKNRYVD ILPYDYNRVT 60 LSTGGEDNYI NASFIEGYRE PKKYIAAQGP KDETVVDFWR MVWEQKSSII VMVTRCEEGN 120 KTKCAQYWPS LDREAEIFEE FVVKIRSEEH CPDYVIRHLI LNNKREKGSE REVTHIQFIS 180 WPDHGVPGDP SLLLKLRRRV NSFKNFFSGP VVVHCSAGVG RTGTYMSIDA MIESLEAEGR 240 VDIYGFVAKL RRQRCLMVQV EAQYILIHTA LIEYNQ 276 // ID cypcaCD45_D2\(BAA92179) STANDARD;PRT; 302 AA. AC BAA92179; DT 17-MAY-2003 DE CD45 [Cyprinus carpio]. OS Cyprinus carpio. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprinus. CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Fujiki,K., Shin,D.H., Nakao,M. and Yano,T. CC GPRFLN| TITLE Molecular cloning of carp (Cyprinus carpio) leucocyte cell-derived CC GPRFLN| chemotaxin 2, glia maturation factor beta, CD45 and lysozyme C by CC GPRFLN| use of suppression subtractive hybridisation CC GPRFLN| JOURNAL Fish Shellfish Immunol. 10 (7), 643-650 (2000) CC GPRFLN| MEDLINE 20531692 CC GPRFLN|REFERENCE 2 (residues 1 to 1216) CC GPRFLN| AUTHORS Fujiki,K., Nakao,M., Shin,D. and Yano,T. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (24-AUG-1999) Kazuhiro Fujiki, Kyushu University, CC GPRFLN| Laboratory of Marine Biochemistry, Faculty of Agriculture; Hakozaki CC GPRFLN| 6-10-1, Higashi-ku, Fukuoka, Fukuoka 812-8581, Japan CC GPRFLN| (E-mail:fujikik@agr.kyushu-u.ac.jp, Tel:81-92-642-2896, CC GPRFLN| Fax:81-92-642-2894) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302454709| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 302 VNTIFKEY:269 FT PROTEIN 1 302 VNTIFKEY:270 SQ SEQUENCE 302 AA; SEFHSVLNTL RQKNGSDPSL LEKEFQKLPK FKKWRTMNTG SSEDNKKKNR DSAVIPYDFN 60 RVIFRLDIEG NQTSDPEDEE EYSSDEEEES NQYINASFID GYWCNKSLIA AQGPLQSTAE 120 EFLLMLYQQQ TKTLVMLTDC QEDGKDYCFQ YWGDEKKTYG DMEIEVKKTE TFPTYVRRHL 180 EIQSLKKKEV LKVDQYQFLK WRGRELPENA QELVEMASII RENGHYDNSK TNRNVPIVVH 240 CNNGSSRTGI FCALWNLLDS AYTEKLVDVL QEVKNLRKLR QGMVETIEQY QFLYTALEGA 300 FP 302 // ID fuCD45_D1\(CAB96211) STANDARD;PRT; 279 AA. AC CAB96211; DT 17-MAY-2003 DE CD45 [Takifugu rubripes]. OS Takifugu rubripes. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Euteleostei; Neoteleostei; Acanthomorpha; Acanthopterygii; Percomorpha; Tetraodontiformes; Tetradontoidea; Tetraodontidae; Takifugu. CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Diaz del Pozo,E.M., Beverley,P.C. and Timon,M. CC GPRFLN| TITLE Genomic structure and sequence of the leukocyte common antigen CC GPRFLN| (CD45) from the pufferfish Fugu rubripes and comparison with its CC GPRFLN| mammalian homologue CC GPRFLN| JOURNAL Unpublished CC GPRFLN|REFERENCE 2 (residues 1 to 1246) CC GPRFLN| AUTHORS Diaz del Pozo,E.M. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (25-JUN-1999) Diaz del Pozo E.M., CD45 Group, The Edward CC GPRFLN| Jenner Institute for Vaccine Research, High Street, Compton, CC GPRFLN| Newbury, Berkshire, RG20 7NN, UNITED KINGDOM CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302488418| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT CHAIN 1 279 VNTIFKEY:203; VNTINAME:Chain_1 SQ SEQUENCE 279 AA; ETLLDAYKRK IADEGRLFLA EFQSIPRIFS KYTVKEAKKS HNVPKNRYVD ILPYDYNRVQ 60 LTTGNGSAGC DYINASFIDG FKELKKYIAA QGPKEETVSN FWRMIWEQQT SIIVMVSRCE 120 EGNRIKCAQY WPSEDRDTEI FEEFIVKLTS EDHYPDYIIR HLSLTNKKDK GSEREVTHIQ 180 FMSWPDHGVP EEAQLLLKLR RRVNSFKNFF SGPIVVHCSA GVGRTGTYIG IDAMMESLEA 240 EGRVDIYGYV VMLRRQRCLM VQVEAQYILI HQALLEHTQ 279 // ID fuCD45_D2\(CAB96211) STANDARD;PRT; 301 AA. AC CAB96211; DT 17-MAY-2003 DE CD45 [Takifugu rubripes]. OS Takifugu rubripes. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Euteleostei; Neoteleostei; Acanthomorpha; Acanthopterygii; Percomorpha; Tetraodontiformes; Tetradontoidea; Tetraodontidae; Takifugu. CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Diaz del Pozo,E.M., Beverley,P.C. and Timon,M. CC GPRFLN| TITLE Genomic structure and sequence of the leukocyte common antigen CC GPRFLN| (CD45) from the pufferfish Fugu rubripes and comparison with its CC GPRFLN| mammalian homologue CC GPRFLN| JOURNAL Unpublished CC GPRFLN|REFERENCE 2 (residues 1 to 1246) CC GPRFLN| AUTHORS Diaz del Pozo,E.M. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (25-JUN-1999) Diaz del Pozo E.M., CD45 Group, The Edward CC GPRFLN| Jenner Institute for Vaccine Research, High Street, Compton, CC GPRFLN| Newbury, Berkshire, RG20 7NN, UNITED KINGDOM CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302488507| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 301 VNTIFKEY:269 FT PROTEIN 1 301 VNTIFKEY:270 FT CHAIN 1 301 VNTIFKEY:203; VNTINAME:Chain_1 SQ SEQUENCE 301 AA; QELHSTLNTL KQRSSDNEPT LLEDEFERLP NFKNWRTFNT GVTEENKKKN RTSSVIPYDY 60 NRVLLKLDEE KSHESDPDPD DDYDTSSYDD IEDSAKYINA SLLSGYWGPH TFISAQTPLP 120 DTVADFWSMI LQKRVSIVVM LSDCSQGDED CVYWGEDKKT VEDIEVETES TDNSPNFILR 180 NMMIHHLKTD AHQQVKHFQF LKWGDKEVPE KPQDLADLIK EIKHRCGYTW PRSTPIIVHC 240 NDGSSRSGAF CALWNLLDNA EKEKMVDVFQ VVKTLRKERQ GMCPSLEQYQ FLYDALEVVY 300 P 301 // ID hBDP1_D1\(NP_055184)\PTPN18 STANDARD;PRT; 288 AA. AC NP_055184; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 18; brain-derived phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X79568.1 and BI261717.1. CC On Jan 25, 2002 this sequence version replaced gi:7657484. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains a PEST motif, which CC often serves as a protein-protein interaction domain, and may be CC related to protein intracellular half-live. This gene was found to CC be expressed in brain, colon tissues, and several different CC tumor-derived cell lines. The bilogical function of this PTP has CC not yet been determined. CC GPRFLN|REFERENCE 1 (residues 1 to 460) CC GPRFLN| AUTHORS Kim,Y.W., Wang,H., Sures,I., Lammers,R., Martell,K.J. and CC GPRFLN| Ullrich,A. CC GPRFLN| TITLE Characterization of the PEST family protein tyrosine phosphatase CC GPRFLN| BDP1 CC GPRFLN| JOURNAL Oncogene 13 (10), 2275-2279 (1996) CC GPRFLN| MEDLINE 97108674 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 288 VNTIFKEY:269 FT PROTEIN 1 288 brain-derived phosphatase FT VNTIFKEY:270 FT REGION 21 287 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 288 AA; DSARSFLERL EARGGREGAV LAGEFSDIQA CSAAWKADGV CSTVAGSRPE NVRKNRYKDV 60 LPYDQTRVIL SLLQEEGHSD YINGNFIRGV DGSLAYIATQ GPLPHTLLDF WRLVWEFGVK 120 VILMACREIE NGRKRCERYW AQEQEPLQTG LFCITLIKEK WLNEDIMLRT LKVTFQKESR 180 SVYQLQYMSW PDRGVPSSPD HMLAMVEEAR RLQGSGPEPL CVHCSAGCGR TGVLCTVDYV 240 RQLLLTQMIP PDFSLFDVVL KMRKQRPAAV QTEEQYRFLY HTVAQMFC 288 // ID hCD45_D1\(NP_002829)\PTPRC STANDARD;PRT; 279 AA. AC NP_002829; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, C isoform 1 precursor; protein tyrosine phosphatase, receptor type, c polypeptide; leukocyte-common antigen; T200 glycoprotein; human homolog of severe combined immunodeficiency due to PTPRC deficiency; SCID due to PTPRC deficiency; CD45 antigen [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from Y00638.1 and Y00062.1. CC On Feb 8, 2002 this sequence version replaced gi:4506307. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC domain, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, and thus belongs to receptor CC type PTP. This gene is specifically expressed in hematopoietic CC cells. This PTP has been shown to be an essential regulator of T- CC and B-cell antigen receptor signaling. It functions through either CC direct interaction with components of the antigen receptor CC complexes, or by activating various Src family kinases required for CC the antigen receptor signaling. This PTP also suppresses JAK CC kinases, and thus functions as a regulator of cytokine receptor CC signaling. Four alternatively spliced transcripts variants of this CC gene, which encode distinct isoforms, have been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1304) CC GPRFLN| AUTHORS Baldwin,T.A. and Ostergaard,H.L. CC GPRFLN| TITLE The protein-tyrosine phosphatase CD45 reaches the cell surface via CC GPRFLN| golgi-dependent and -independent pathways CC GPRFLN| JOURNAL J. Biol. Chem. 277 (52), 50333-50340 (2002) CC GPRFLN| MEDLINE 22384317 CC GPRFLN| REMARK GeneRIF: reaches the cell surface via Golgi-dependent and CC GPRFLN| -independent pathways CC GPRFLN|REFERENCE 2 (residues 1 to 1304) CC GPRFLN| AUTHORS Harashima,A., Suzuki,M., Okochi,A., Yamamoto,M., Matsuo,Y., CC GPRFLN| Motoda,R., Yoshioka,T. and Orita,K. CC GPRFLN| TITLE CD45 tyrosine phosphatase inhibits erythroid differentiation of CC GPRFLN| umbilical cord blood CD34+ cells associated with selective CC GPRFLN| inactivation of Lyn CC GPRFLN| JOURNAL Blood 100 (13), 4440-4445 (2002) CC GPRFLN| MEDLINE 22340750 CC GPRFLN| REMARK GeneRIF: CD45 may play a pivotal role in erythropoiesis. CD45 CC GPRFLN| tyrosine phosphatase inhibits erythroid differentiation of CC GPRFLN| umbilical cord blood CD34+ cells associated with selective CC GPRFLN| inactivation of Lyn. CC GPRFLN|REFERENCE 3 (residues 1 to 1304) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 4 (residues 1 to 1304) CC GPRFLN| AUTHORS Pradhan,D. and Morrow,J. CC GPRFLN| TITLE The spectrin-ankyrin skeleton controls CD45 surface display and CC GPRFLN| interleukin-2 production CC GPRFLN| JOURNAL Immunity 17 (3), 303-315 (2002) CC GPRFLN| MEDLINE 22241694 CC GPRFLN| REMARK GeneRIF: The spectrin-ankyrin skeleton controls CD45 surface CC GPRFLN| display and interleukin-2 production. CC GPRFLN|REFERENCE 5 (residues 1 to 1304) CC GPRFLN| AUTHORS Ballerini,C., Rosati,E., Salvetti,M., Ristori,G., Cannoni,S., CC GPRFLN| Biagioli,T., Massacesi,L., Sorbi,S. and Vergelli,M. CC GPRFLN| TITLE Protein tyrosine phosphatase receptor-type C exon 4 gene mutation CC GPRFLN| distribution in an Italian multiple sclerosis population CC GPRFLN| JOURNAL Neurosci. Lett. 328 (3), 325-327 (2002) CC GPRFLN| MEDLINE 22142931 CC GPRFLN| REMARK GeneRIF: Role of the C-->G mutation in position 77 of exon 4 of the CC GPRFLN| protein tyrosine phosphatase receptor-type C (PTPRC) gene, coding CC GPRFLN| for the CD45 molecule, for the development of multiple sclerosis CC GPRFLN| (MS) in Italy. CC GPRFLN|REFERENCE 6 (residues 1 to 1304) CC GPRFLN| AUTHORS Yamada,T., Zhu,D., Saxon,A. and Zhang,K. CC GPRFLN| TITLE CD45 controls interleukin-4-mediated IgE class switch recombination CC GPRFLN| in human B cells through its function as a Janus kinase phosphatase CC GPRFLN| JOURNAL J. Biol. Chem. 277 (32), 28830-28835 (2002) CC GPRFLN| MEDLINE 22151051 CC GPRFLN| REMARK GeneRIF: CD45 controls interleukin-4-mediated IgE class switch CC GPRFLN| recombination in human B cells CC GPRFLN|REFERENCE 7 (residues 1 to 1304) CC GPRFLN| AUTHORS Yu,C., Yu,H.S., Sun,K.H., Hsieh,S.C. and Tsai,C.Y. CC GPRFLN| TITLE Anti-CD45 isoform antibodies enhance phagocytosis and gene CC GPRFLN| expression of IL-8 and TNF-alpha in human neutrophils by CC GPRFLN| differential suppression on protein tyrosine phosphorylation and CC GPRFLN| p56lck tyrosine kinase CC GPRFLN| JOURNAL Clin. Exp. Immunol. 129 (1), 78-85 (2002) CC GPRFLN| MEDLINE 22095000 CC GPRFLN| REMARK GeneRIF: Biological functions of membrane expressed CD45 isoforms CC GPRFLN| on PMNs were studied. Cross-linking of CD45 isoforms by specific CC GPRFLN| MAbs stimulated different PMN activities by differential CC GPRFLN| suppression on protein tyrosine phosphorylation and p56lck. CC GPRFLN|REFERENCE 8 (residues 1 to 1304) CC GPRFLN| AUTHORS Jacobsen,M., Hoffmann,S., Cepok,S., Stei,S., Ziegler,A., Sommer,N. CC GPRFLN| and Hemmer,B. CC GPRFLN| TITLE A novel mutation in PTPRC interferes with splicing and alters the CC GPRFLN| structure of the human CD45 molecule CC GPRFLN| JOURNAL Immunogenetics 54 (3), 158-163 (2002) CC GPRFLN| MEDLINE 22067726 CC GPRFLN| REMARK GeneRIF: a mutation in PTPRC interferes with splicing and alters CC GPRFLN| the structure of the CD45 molecule CC GPRFLN|REFERENCE 9 (residues 1 to 1304) CC GPRFLN| AUTHORS Tchilian,E.Z. and Beverley,P.C. CC GPRFLN| TITLE CD45 in memory and disease CC GPRFLN| JOURNAL Arch. Immunol. Ther. Exp. (Warsz.) 50 (2), 85-93 (2002) CC GPRFLN| MEDLINE 22017393 CC GPRFLN| REMARK GeneRIF: Role of high and low molecular weight isoforms of CD45 in CC GPRFLN| the function of na##ve and memory T lymphocytes. Review. CC GPRFLN|REFERENCE 10 (residues 1 to 1304) CC GPRFLN| AUTHORS Fajka-Boja,R., Szemes,M., Ion,G., Legradi,A., Caron,M. and CC GPRFLN| Monostori,E. CC GPRFLN| TITLE Receptor tyrosine phosphatase, CD45 binds galectin-1 but does not CC GPRFLN| mediate its apoptotic signal in T cell lines CC GPRFLN| JOURNAL Immunol. Lett. 82 (1-2), 149-154 (2002) CC GPRFLN| MEDLINE 22003829 CC GPRFLN| REMARK GeneRIF: Receptor tyrosine phosphatase, CD45 binds galectin-1 but CC GPRFLN| does not mediate its apoptotic signal in Jurkat cells CC GPRFLN|REFERENCE 11 (residues 1 to 1304) CC GPRFLN| AUTHORS Fukuhara,K., Okumura,M., Shiono,H., Inoue,M., Kadota,Y., Miyoshi,S. CC GPRFLN| and Matsuda,H. CC GPRFLN| TITLE A study on CD45 isoform expression during T-cell development and CC GPRFLN| selection events in the human thymus CC GPRFLN| JOURNAL Hum. Immunol. 63 (5), 394-404 (2002) CC GPRFLN| MEDLINE 21972715 CC GPRFLN| REMARK GeneRIF: analysis of CD45 isoform expression during T-cell CC GPRFLN| development and selection in the human thymus CC GPRFLN|REFERENCE 12 (residues 1 to 1304) CC GPRFLN| AUTHORS Wu,L., Fu,J. and Shen,S.H. CC GPRFLN| TITLE SKAP55 coupled with CD45 positively regulates T-cell CC GPRFLN| receptor-mediated gene transcription CC GPRFLN| JOURNAL Mol. Cell. Biol. 22 (8), 2673-2686 (2002) CC GPRFLN| MEDLINE 21907230 CC GPRFLN| REMARK GeneRIF: SKAP55 coupled with CD45 positively regulates T-cell CC GPRFLN| receptor-mediated gene transcription. CC GPRFLN|REFERENCE 13 (residues 1 to 1304) CC GPRFLN| AUTHORS Ishikawa,H., Tsuyama,N., Abroun,S., Liu,S., Li,F.J., Taniguchi,O. CC GPRFLN| and Kawano,M.M. CC GPRFLN| TITLE Requirements of src family kinase activity associated with CD45 for CC GPRFLN| myeloma cell proliferation by interleukin-6 CC GPRFLN| JOURNAL Blood 99 (6), 2172-2178 (2002) CC GPRFLN| MEDLINE 21866149 CC GPRFLN| REMARK GeneRIF: Requirements of src family kinase activity associated with CC GPRFLN| CD45 for myeloma cell proliferation by interleukin-6 CC GPRFLN|REFERENCE 14 (residues 1 to 1304) CC GPRFLN| AUTHORS Tchilian,E.Z., Dawes,R., Ramaley,P.A., Whitworth,J.A., CC GPRFLN| Yuldasheva,N., Wells,R.S., Watera,C., French,N., Gilks,C.F., CC GPRFLN| Kunachiwa,W., Ruzibakiev,R., Leetrakool,N., Carrington,C.V., CC GPRFLN| Ramdath,D.D., Gotch,F., Stephens,H.A., Hill,A.V. and Beverley,P.C. CC GPRFLN| TITLE A CD45 polymorphism associated with abnormal splicing is absent in CC GPRFLN| African populations CC GPRFLN| JOURNAL Immunogenetics 53 (10-11), 980-983 (2002) CC GPRFLN| MEDLINE 21850514 CC GPRFLN| REMARK GeneRIF: we examined the frequency of the C77G allele in African CC GPRFLN| and Asian populations from countries with high or low prevalence of CC GPRFLN| HIV infection; Here we report that the variant CD45 C77G allele is CC GPRFLN| absent in African populations CC GPRFLN|REFERENCE 15 (residues 1 to 1304) CC GPRFLN| AUTHORS Wood,J.P., Bieda,K., Segni,M., Herwig,J., Krause,M., Usadel,K.H. CC GPRFLN| and Badenhoop,K. CC GPRFLN| TITLE CD45 exon 4 point mutation does not confer susceptibility to type 1 CC GPRFLN| diabetes mellitus or Graves' disease CC GPRFLN| JOURNAL Eur. J. Immunogenet. 29 (1), 73-74 (2002) CC GPRFLN| MEDLINE 21830605 CC GPRFLN| REMARK GeneRIF: CD45 variant (C77G, exon 4) does not confer susceptibility CC GPRFLN| to either IDDM or Graves' disease CC GPRFLN|REFERENCE 16 (residues 1 to 1304) CC GPRFLN| AUTHORS Moro,H., Iwai,K., Mori,N., Watanabe,M., Fukushi,M., Oie,M., CC GPRFLN| Arai,M., Tanaka,Y., Miyawaki,T., Gejyo,F., Arakawa,M. and Fujii,M. CC GPRFLN| TITLE Interleukin-2-dependent but not independent T-cell lines infected CC GPRFLN| with human T-cell leukemia virus type 1 selectively express CD45RO, CC GPRFLN| a marker for persistent infection in vivo CC GPRFLN| JOURNAL Virus Genes 23 (3), 263-271 (2001) CC GPRFLN| MEDLINE 21636965 CC GPRFLN| REMARK GeneRIF: role of CD45RO in the persistent HTLV-1 infection in vivo CC GPRFLN|REFERENCE 17 (residues 1 to 1304) CC GPRFLN| AUTHORS Irie-Sasaki,J., Sasaki,T., Matsumoto,W., Opavsky,A., Cheng,M., CC GPRFLN| Welstead,G., Griffiths,E., Krawczyk,C., Richardson,C.D., Aitken,K., CC GPRFLN| Iscove,N., Koretzky,G., Johnson,P., Liu,P., Rothstein,D.M. and CC GPRFLN| Penninger,J.M. CC GPRFLN| TITLE CD45 is a JAK phosphatase and negatively regulates cytokine CC GPRFLN| receptor signalling CC GPRFLN| JOURNAL Nature 409 (6818), 349-354 (2001) CC GPRFLN| MEDLINE 21069057 CC GPRFLN|REFERENCE 18 (residues 1 to 1304) CC GPRFLN| AUTHORS Goff,L.K., van Soest,S., Timon,M., Tchilian,E. and Beverley,P.C. CC GPRFLN| TITLE Protein tyrosine phosphatase receptor type C polypeptide (PTPRC) on CC GPRFLN| human chromosome band 1q31-->q32 localizes with marker D1S413(1) on CC GPRFLN| a 610-kb yeast artificial chromosome CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 87 (3-4), 223-224 (1999) CC GPRFLN| MEDLINE 20169194 CC GPRFLN|REFERENCE 19 (residues 1 to 1304) CC GPRFLN| AUTHORS Petricoin,E.F. III, Ito,S., Williams,B.L., Audet,S., Stancato,L.F., CC GPRFLN| Gamero,A., Clouse,K., Grimley,P., Weiss,A., Beeler,J., CC GPRFLN| Finbloom,D.S., Shores,E.W., Abraham,R. and Larner,A.C. CC GPRFLN| TITLE Antiproliferative action of interferon-alpha requires components of CC GPRFLN| T-cell-receptor signalling CC GPRFLN| JOURNAL Nature 390 (6660), 629-632 (1997) CC GPRFLN| MEDLINE 98065953 CC GPRFLN|REFERENCE 20 (residues 1 to 1304) CC GPRFLN| AUTHORS Kaplan,R., Morse,B., Huebner,K., Croce,C., Howk,R., Ravera,M., CC GPRFLN| Ricca,G., Jaye,M. and Schlessinger,J. CC GPRFLN| TITLE Cloning of three human tyrosine phosphatases reveals a multigene CC GPRFLN| family of receptor-linked protein-tyrosine-phosphatases expressed CC GPRFLN| in brain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7000-7004 (1990) CC GPRFLN| MEDLINE 90384936 CC GPRFLN|REFERENCE 21 (residues 1 to 1304) CC GPRFLN| AUTHORS Schraven,B., Samstag,Y., Altevogt,P. and Meuer,S.C. CC GPRFLN| TITLE Association of CD2 and CD45 on human T lymphocytes CC GPRFLN| JOURNAL Nature 345 (6270), 71-74 (1990) CC GPRFLN| MEDLINE 90231464 CC GPRFLN|REFERENCE 22 (residues 1 to 1304) CC GPRFLN| AUTHORS Pingel,J.T. and Thomas,M.L. CC GPRFLN| TITLE Evidence that the leukocyte-common antigen is required for CC GPRFLN| antigen-induced T lymphocyte proliferation CC GPRFLN| JOURNAL Cell 58 (6), 1055-1065 (1989) CC GPRFLN| MEDLINE 89376557 CC GPRFLN|REFERENCE 23 (residues 1 to 1304) CC GPRFLN| AUTHORS Charbonneau,H., Tonks,N.K., Walsh,K.A. and Fischer,E.H. CC GPRFLN| TITLE The leukocyte common antigen (CD45): a putative receptor-linked CC GPRFLN| protein tyrosine phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 85 (19), 7182-7186 (1988) CC GPRFLN| MEDLINE 89017162 CC GPRFLN|REFERENCE 24 (residues 1 to 1304) CC GPRFLN| AUTHORS Streuli,M., Hall,L.R., Saga,Y., Schlossman,S.F. and Saito,H. CC GPRFLN| TITLE Differential usage of three exons generates at least five different CC GPRFLN| mRNAs encoding human leukocyte common antigens CC GPRFLN| JOURNAL J. Exp. Med. 166 (5), 1548-1566 (1987) CC GPRFLN| MEDLINE 88061067 CC GPRFLN|REFERENCE 25 (residues 1 to 1304) CC GPRFLN| AUTHORS Ralph,S.J., Thomas,M.L., Morton,C.C. and Trowbridge,I.S. CC GPRFLN| TITLE Structural variants of human T200 glycoprotein (leukocyte-common CC GPRFLN| antigen) CC GPRFLN| JOURNAL EMBO J. 6 (5), 1251-1257 (1987) CC GPRFLN| MEDLINE 87275816 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 protein tyrosine phosphatase, receptor type, c polypeptide; leukocyte-common antigen; T200 glycoprotein; human homolog of severe combined immunodeficiency due to PTPRC deficiency; SCID due to PTPRC deficiency; CD45 antigen FT VNTIFKEY:270 FT CHAIN 1 279 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 277 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 279 AA; DILLETYKRK IADEGRLFLA EFQSIPRVFS KFPIKEARKP FNQNKNRYVD ILPYDYNRVE 60 LSEINGDAGS NYINASYIDG FKEPRKYIAA QGPRDETVDD FWRMIWEQKA TVIVMVTRCE 120 EGNRNKCAEY WPSMEEGTRA FGDVVVKINQ HKRCPDYIIQ KLNIVNKKEK ATGREVTHIQ 180 FTSWPDHGVP EDPHLLLKLR RRVNAFSNFF SGPIVVHCSA GVGRTGTYIG IDAMLEGLEA 240 ENKVDVYGYV VKLRRQRCLM VQVEAQYILI HQALVEYNQ 279 // ID hCD45_D2\(NP_002829)\PTPRC STANDARD;PRT; 308 AA. AC NP_002829; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, C isoform 1 precursor; protein tyrosine phosphatase, receptor type, c polypeptide; leukocyte-common antigen; T200 glycoprotein; human homolog of severe combined immunodeficiency due to PTPRC deficiency; SCID due to PTPRC deficiency; CD45 antigen [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from Y00638.1 and Y00062.1. CC On Feb 8, 2002 this sequence version replaced gi:4506307. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC domain, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, and thus belongs to receptor CC type PTP. This gene is specifically expressed in hematopoietic CC cells. This PTP has been shown to be an essential regulator of T- CC and B-cell antigen receptor signaling. It functions through either CC direct interaction with components of the antigen receptor CC complexes, or by activating various Src family kinases required for CC the antigen receptor signaling. This PTP also suppresses JAK CC kinases, and thus functions as a regulator of cytokine receptor CC signaling. Four alternatively spliced transcripts variants of this CC gene, which encode distinct isoforms, have been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1304) CC GPRFLN| AUTHORS Baldwin,T.A. and Ostergaard,H.L. CC GPRFLN| TITLE The protein-tyrosine phosphatase CD45 reaches the cell surface via CC GPRFLN| golgi-dependent and -independent pathways CC GPRFLN| JOURNAL J. Biol. Chem. 277 (52), 50333-50340 (2002) CC GPRFLN| MEDLINE 22384317 CC GPRFLN| REMARK GeneRIF: reaches the cell surface via Golgi-dependent and CC GPRFLN| -independent pathways CC GPRFLN|REFERENCE 2 (residues 1 to 1304) CC GPRFLN| AUTHORS Harashima,A., Suzuki,M., Okochi,A., Yamamoto,M., Matsuo,Y., CC GPRFLN| Motoda,R., Yoshioka,T. and Orita,K. CC GPRFLN| TITLE CD45 tyrosine phosphatase inhibits erythroid differentiation of CC GPRFLN| umbilical cord blood CD34+ cells associated with selective CC GPRFLN| inactivation of Lyn CC GPRFLN| JOURNAL Blood 100 (13), 4440-4445 (2002) CC GPRFLN| MEDLINE 22340750 CC GPRFLN| REMARK GeneRIF: CD45 may play a pivotal role in erythropoiesis. CD45 CC GPRFLN| tyrosine phosphatase inhibits erythroid differentiation of CC GPRFLN| umbilical cord blood CD34+ cells associated with selective CC GPRFLN| inactivation of Lyn. CC GPRFLN|REFERENCE 3 (residues 1 to 1304) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 4 (residues 1 to 1304) CC GPRFLN| AUTHORS Pradhan,D. and Morrow,J. CC GPRFLN| TITLE The spectrin-ankyrin skeleton controls CD45 surface display and CC GPRFLN| interleukin-2 production CC GPRFLN| JOURNAL Immunity 17 (3), 303-315 (2002) CC GPRFLN| MEDLINE 22241694 CC GPRFLN| REMARK GeneRIF: The spectrin-ankyrin skeleton controls CD45 surface CC GPRFLN| display and interleukin-2 production. CC GPRFLN|REFERENCE 5 (residues 1 to 1304) CC GPRFLN| AUTHORS Ballerini,C., Rosati,E., Salvetti,M., Ristori,G., Cannoni,S., CC GPRFLN| Biagioli,T., Massacesi,L., Sorbi,S. and Vergelli,M. CC GPRFLN| TITLE Protein tyrosine phosphatase receptor-type C exon 4 gene mutation CC GPRFLN| distribution in an Italian multiple sclerosis population CC GPRFLN| JOURNAL Neurosci. Lett. 328 (3), 325-327 (2002) CC GPRFLN| MEDLINE 22142931 CC GPRFLN| REMARK GeneRIF: Role of the C-->G mutation in position 77 of exon 4 of the CC GPRFLN| protein tyrosine phosphatase receptor-type C (PTPRC) gene, coding CC GPRFLN| for the CD45 molecule, for the development of multiple sclerosis CC GPRFLN| (MS) in Italy. CC GPRFLN|REFERENCE 6 (residues 1 to 1304) CC GPRFLN| AUTHORS Yamada,T., Zhu,D., Saxon,A. and Zhang,K. CC GPRFLN| TITLE CD45 controls interleukin-4-mediated IgE class switch recombination CC GPRFLN| in human B cells through its function as a Janus kinase phosphatase CC GPRFLN| JOURNAL J. Biol. Chem. 277 (32), 28830-28835 (2002) CC GPRFLN| MEDLINE 22151051 CC GPRFLN| REMARK GeneRIF: CD45 controls interleukin-4-mediated IgE class switch CC GPRFLN| recombination in human B cells CC GPRFLN|REFERENCE 7 (residues 1 to 1304) CC GPRFLN| AUTHORS Yu,C., Yu,H.S., Sun,K.H., Hsieh,S.C. and Tsai,C.Y. CC GPRFLN| TITLE Anti-CD45 isoform antibodies enhance phagocytosis and gene CC GPRFLN| expression of IL-8 and TNF-alpha in human neutrophils by CC GPRFLN| differential suppression on protein tyrosine phosphorylation and CC GPRFLN| p56lck tyrosine kinase CC GPRFLN| JOURNAL Clin. Exp. Immunol. 129 (1), 78-85 (2002) CC GPRFLN| MEDLINE 22095000 CC GPRFLN| REMARK GeneRIF: Biological functions of membrane expressed CD45 isoforms CC GPRFLN| on PMNs were studied. Cross-linking of CD45 isoforms by specific CC GPRFLN| MAbs stimulated different PMN activities by differential CC GPRFLN| suppression on protein tyrosine phosphorylation and p56lck. CC GPRFLN|REFERENCE 8 (residues 1 to 1304) CC GPRFLN| AUTHORS Jacobsen,M., Hoffmann,S., Cepok,S., Stei,S., Ziegler,A., Sommer,N. CC GPRFLN| and Hemmer,B. CC GPRFLN| TITLE A novel mutation in PTPRC interferes with splicing and alters the CC GPRFLN| structure of the human CD45 molecule CC GPRFLN| JOURNAL Immunogenetics 54 (3), 158-163 (2002) CC GPRFLN| MEDLINE 22067726 CC GPRFLN| REMARK GeneRIF: a mutation in PTPRC interferes with splicing and alters CC GPRFLN| the structure of the CD45 molecule CC GPRFLN|REFERENCE 9 (residues 1 to 1304) CC GPRFLN| AUTHORS Tchilian,E.Z. and Beverley,P.C. CC GPRFLN| TITLE CD45 in memory and disease CC GPRFLN| JOURNAL Arch. Immunol. Ther. Exp. (Warsz.) 50 (2), 85-93 (2002) CC GPRFLN| MEDLINE 22017393 CC GPRFLN| REMARK GeneRIF: Role of high and low molecular weight isoforms of CD45 in CC GPRFLN| the function of na##ve and memory T lymphocytes. Review. CC GPRFLN|REFERENCE 10 (residues 1 to 1304) CC GPRFLN| AUTHORS Fajka-Boja,R., Szemes,M., Ion,G., Legradi,A., Caron,M. and CC GPRFLN| Monostori,E. CC GPRFLN| TITLE Receptor tyrosine phosphatase, CD45 binds galectin-1 but does not CC GPRFLN| mediate its apoptotic signal in T cell lines CC GPRFLN| JOURNAL Immunol. Lett. 82 (1-2), 149-154 (2002) CC GPRFLN| MEDLINE 22003829 CC GPRFLN| REMARK GeneRIF: Receptor tyrosine phosphatase, CD45 binds galectin-1 but CC GPRFLN| does not mediate its apoptotic signal in Jurkat cells CC GPRFLN|REFERENCE 11 (residues 1 to 1304) CC GPRFLN| AUTHORS Fukuhara,K., Okumura,M., Shiono,H., Inoue,M., Kadota,Y., Miyoshi,S. CC GPRFLN| and Matsuda,H. CC GPRFLN| TITLE A study on CD45 isoform expression during T-cell development and CC GPRFLN| selection events in the human thymus CC GPRFLN| JOURNAL Hum. Immunol. 63 (5), 394-404 (2002) CC GPRFLN| MEDLINE 21972715 CC GPRFLN| REMARK GeneRIF: analysis of CD45 isoform expression during T-cell CC GPRFLN| development and selection in the human thymus CC GPRFLN|REFERENCE 12 (residues 1 to 1304) CC GPRFLN| AUTHORS Wu,L., Fu,J. and Shen,S.H. CC GPRFLN| TITLE SKAP55 coupled with CD45 positively regulates T-cell CC GPRFLN| receptor-mediated gene transcription CC GPRFLN| JOURNAL Mol. Cell. Biol. 22 (8), 2673-2686 (2002) CC GPRFLN| MEDLINE 21907230 CC GPRFLN| REMARK GeneRIF: SKAP55 coupled with CD45 positively regulates T-cell CC GPRFLN| receptor-mediated gene transcription. CC GPRFLN|REFERENCE 13 (residues 1 to 1304) CC GPRFLN| AUTHORS Ishikawa,H., Tsuyama,N., Abroun,S., Liu,S., Li,F.J., Taniguchi,O. CC GPRFLN| and Kawano,M.M. CC GPRFLN| TITLE Requirements of src family kinase activity associated with CD45 for CC GPRFLN| myeloma cell proliferation by interleukin-6 CC GPRFLN| JOURNAL Blood 99 (6), 2172-2178 (2002) CC GPRFLN| MEDLINE 21866149 CC GPRFLN| REMARK GeneRIF: Requirements of src family kinase activity associated with CC GPRFLN| CD45 for myeloma cell proliferation by interleukin-6 CC GPRFLN|REFERENCE 14 (residues 1 to 1304) CC GPRFLN| AUTHORS Tchilian,E.Z., Dawes,R., Ramaley,P.A., Whitworth,J.A., CC GPRFLN| Yuldasheva,N., Wells,R.S., Watera,C., French,N., Gilks,C.F., CC GPRFLN| Kunachiwa,W., Ruzibakiev,R., Leetrakool,N., Carrington,C.V., CC GPRFLN| Ramdath,D.D., Gotch,F., Stephens,H.A., Hill,A.V. and Beverley,P.C. CC GPRFLN| TITLE A CD45 polymorphism associated with abnormal splicing is absent in CC GPRFLN| African populations CC GPRFLN| JOURNAL Immunogenetics 53 (10-11), 980-983 (2002) CC GPRFLN| MEDLINE 21850514 CC GPRFLN| REMARK GeneRIF: we examined the frequency of the C77G allele in African CC GPRFLN| and Asian populations from countries with high or low prevalence of CC GPRFLN| HIV infection; Here we report that the variant CD45 C77G allele is CC GPRFLN| absent in African populations CC GPRFLN|REFERENCE 15 (residues 1 to 1304) CC GPRFLN| AUTHORS Wood,J.P., Bieda,K., Segni,M., Herwig,J., Krause,M., Usadel,K.H. CC GPRFLN| and Badenhoop,K. CC GPRFLN| TITLE CD45 exon 4 point mutation does not confer susceptibility to type 1 CC GPRFLN| diabetes mellitus or Graves' disease CC GPRFLN| JOURNAL Eur. J. Immunogenet. 29 (1), 73-74 (2002) CC GPRFLN| MEDLINE 21830605 CC GPRFLN| REMARK GeneRIF: CD45 variant (C77G, exon 4) does not confer susceptibility CC GPRFLN| to either IDDM or Graves' disease CC GPRFLN|REFERENCE 16 (residues 1 to 1304) CC GPRFLN| AUTHORS Moro,H., Iwai,K., Mori,N., Watanabe,M., Fukushi,M., Oie,M., CC GPRFLN| Arai,M., Tanaka,Y., Miyawaki,T., Gejyo,F., Arakawa,M. and Fujii,M. CC GPRFLN| TITLE Interleukin-2-dependent but not independent T-cell lines infected CC GPRFLN| with human T-cell leukemia virus type 1 selectively express CD45RO, CC GPRFLN| a marker for persistent infection in vivo CC GPRFLN| JOURNAL Virus Genes 23 (3), 263-271 (2001) CC GPRFLN| MEDLINE 21636965 CC GPRFLN| REMARK GeneRIF: role of CD45RO in the persistent HTLV-1 infection in vivo CC GPRFLN|REFERENCE 17 (residues 1 to 1304) CC GPRFLN| AUTHORS Irie-Sasaki,J., Sasaki,T., Matsumoto,W., Opavsky,A., Cheng,M., CC GPRFLN| Welstead,G., Griffiths,E., Krawczyk,C., Richardson,C.D., Aitken,K., CC GPRFLN| Iscove,N., Koretzky,G., Johnson,P., Liu,P., Rothstein,D.M. and CC GPRFLN| Penninger,J.M. CC GPRFLN| TITLE CD45 is a JAK phosphatase and negatively regulates cytokine CC GPRFLN| receptor signalling CC GPRFLN| JOURNAL Nature 409 (6818), 349-354 (2001) CC GPRFLN| MEDLINE 21069057 CC GPRFLN|REFERENCE 18 (residues 1 to 1304) CC GPRFLN| AUTHORS Goff,L.K., van Soest,S., Timon,M., Tchilian,E. and Beverley,P.C. CC GPRFLN| TITLE Protein tyrosine phosphatase receptor type C polypeptide (PTPRC) on CC GPRFLN| human chromosome band 1q31-->q32 localizes with marker D1S413(1) on CC GPRFLN| a 610-kb yeast artificial chromosome CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 87 (3-4), 223-224 (1999) CC GPRFLN| MEDLINE 20169194 CC GPRFLN|REFERENCE 19 (residues 1 to 1304) CC GPRFLN| AUTHORS Petricoin,E.F. III, Ito,S., Williams,B.L., Audet,S., Stancato,L.F., CC GPRFLN| Gamero,A., Clouse,K., Grimley,P., Weiss,A., Beeler,J., CC GPRFLN| Finbloom,D.S., Shores,E.W., Abraham,R. and Larner,A.C. CC GPRFLN| TITLE Antiproliferative action of interferon-alpha requires components of CC GPRFLN| T-cell-receptor signalling CC GPRFLN| JOURNAL Nature 390 (6660), 629-632 (1997) CC GPRFLN| MEDLINE 98065953 CC GPRFLN|REFERENCE 20 (residues 1 to 1304) CC GPRFLN| AUTHORS Kaplan,R., Morse,B., Huebner,K., Croce,C., Howk,R., Ravera,M., CC GPRFLN| Ricca,G., Jaye,M. and Schlessinger,J. CC GPRFLN| TITLE Cloning of three human tyrosine phosphatases reveals a multigene CC GPRFLN| family of receptor-linked protein-tyrosine-phosphatases expressed CC GPRFLN| in brain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7000-7004 (1990) CC GPRFLN| MEDLINE 90384936 CC GPRFLN|REFERENCE 21 (residues 1 to 1304) CC GPRFLN| AUTHORS Schraven,B., Samstag,Y., Altevogt,P. and Meuer,S.C. CC GPRFLN| TITLE Association of CD2 and CD45 on human T lymphocytes CC GPRFLN| JOURNAL Nature 345 (6270), 71-74 (1990) CC GPRFLN| MEDLINE 90231464 CC GPRFLN|REFERENCE 22 (residues 1 to 1304) CC GPRFLN| AUTHORS Pingel,J.T. and Thomas,M.L. CC GPRFLN| TITLE Evidence that the leukocyte-common antigen is required for CC GPRFLN| antigen-induced T lymphocyte proliferation CC GPRFLN| JOURNAL Cell 58 (6), 1055-1065 (1989) CC GPRFLN| MEDLINE 89376557 CC GPRFLN|REFERENCE 23 (residues 1 to 1304) CC GPRFLN| AUTHORS Charbonneau,H., Tonks,N.K., Walsh,K.A. and Fischer,E.H. CC GPRFLN| TITLE The leukocyte common antigen (CD45): a putative receptor-linked CC GPRFLN| protein tyrosine phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 85 (19), 7182-7186 (1988) CC GPRFLN| MEDLINE 89017162 CC GPRFLN|REFERENCE 24 (residues 1 to 1304) CC GPRFLN| AUTHORS Streuli,M., Hall,L.R., Saga,Y., Schlossman,S.F. and Saito,H. CC GPRFLN| TITLE Differential usage of three exons generates at least five different CC GPRFLN| mRNAs encoding human leukocyte common antigens CC GPRFLN| JOURNAL J. Exp. Med. 166 (5), 1548-1566 (1987) CC GPRFLN| MEDLINE 88061067 CC GPRFLN|REFERENCE 25 (residues 1 to 1304) CC GPRFLN| AUTHORS Ralph,S.J., Thomas,M.L., Morton,C.C. and Trowbridge,I.S. CC GPRFLN| TITLE Structural variants of human T200 glycoprotein (leukocyte-common CC GPRFLN| antigen) CC GPRFLN| JOURNAL EMBO J. 6 (5), 1251-1257 (1987) CC GPRFLN| MEDLINE 87275816 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 308 VNTIFKEY:269 FT PROTEIN 1 308 protein tyrosine phosphatase, receptor type, c polypeptide; leukocyte-common antigen; T200 glycoprotein; human homolog of severe combined immunodeficiency due to PTPRC deficiency; SCID due to PTPRC deficiency; CD45 antigen FT VNTIFKEY:270 FT CHAIN 1 308 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 22 307 PTPc FT VNTIFKEY:266; VNTINAME:Region_3 SQ SEQUENCE 308 AA; SELHPYLHNM KKRDPPSEPS PLEAEFQRLP SYRSWRTQHI GNQEENKSKN RNSNVIPYDY 60 NRVPLKHELE MSKESEHDSD ESSDDDSDSE EPSKYINASF IMSYWKPEVM IAAQGPLKET 120 IGDFWQMIFQ RKVKVIVMLT ELKHGDQEIC AQYWGEGKQT YGDIEVDLKD TDKSSTYTLR 180 VFELRHSKRK DSRTVYQYQY TNWSVEQLPA EPKELISMIQ VVKQKLPQKN SSEGNKHHKS 240 TPLLIHCRDG SQQTGIFCAL LNLLESAETE EVVDIFQVVK ALRKARPGMV STFEQYQFLY 300 DVIASTYP 308 // ID hDEP1_D1\(NP_002834)\PTPRJ STANDARD;PRT; 277 AA. AC NP_002834; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, J precursor; protein tyrosine phosphatase, receptor type, J polypeptide; human density enhanced phosphatase-1; CD148 antigen [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from U10886.1. CC On Feb 22, 2002 this sequence version replaced gi:4506315. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region containing five fibronectin type III repeats, a single CC transmembrane region, and a single intracytoplasmic catalytic CC domain, and thus represents a receptor-type PTP. This PTP is CC present in all hematopoietic lineages, and was shown to negatively CC regulate T cell receptor signaling possibly through interfering CC with the phosphorylation of Phospholipase C Gamma 1 (PLCG1) and CC Linker for Activation of T Cells (LAT). This PTP was also found to CC dephosphorylate PDGF beta receptor, and may be involved in CC UV-induced signal transduction. CC GPRFLN|REFERENCE 1 (residues 1 to 1337) CC GPRFLN| AUTHORS Ruivenkamp,C.A., van Wezel,T., Zanon,C., Stassen,A.P., Vlcek,C., CC GPRFLN| Csikos,T., Klous,A.M., Tripodis,N., Perrakis,A., Boerrigter,L., CC GPRFLN| Groot,P.C., Lindeman,J., Mooi,W.J., Meijjer,G.A., Scholten,G., CC GPRFLN| Dauwerse,H., Paces,V., van Zandwijk,N., van Ommen,G.J. and CC GPRFLN| Demant,P. CC GPRFLN| TITLE Ptprj is a candidate for the mouse colon-cancer susceptibility CC GPRFLN| locus Scc1 and is frequently deleted in human cancers CC GPRFLN| JOURNAL Nat. Genet. 31 (3), 295-300 (2002) CC GPRFLN| MEDLINE 22084388 CC GPRFLN| REMARK GeneRIF: This protein is frequently deleted in human breast CC GPRFLN| cancers. CC GPRFLN|REFERENCE 2 (residues 1 to 1337) CC GPRFLN| AUTHORS Baker,J.E., Majeti,R., Tangye,S.G. and Weiss,A. CC GPRFLN| TITLE Protein tyrosine phosphatase CD148-mediated inhibition of T-cell CC GPRFLN| receptor signal transduction is associated with reduced LAT and CC GPRFLN| phospholipase Cgamma1 phosphorylation CC GPRFLN| JOURNAL Mol. Cell. Biol. 21 (7), 2393-2403 (2001) CC GPRFLN| MEDLINE 21160271 CC GPRFLN|REFERENCE 3 (residues 1 to 1337) CC GPRFLN| AUTHORS Kovalenko,M., Denner,K., Sandstrom,J., Persson,C., Gross,S., CC GPRFLN| Jandt,E., Vilella,R., Bohmer,F. and Ostman,A. CC GPRFLN| TITLE Site-selective dephosphorylation of the platelet-derived growth CC GPRFLN| factor beta-receptor by the receptor-like protein-tyrosine CC GPRFLN| phosphatase DEP-1 CC GPRFLN| JOURNAL J. Biol. Chem. 275 (21), 16219-16226 (2000) CC GPRFLN| MEDLINE 20283660 CC GPRFLN|REFERENCE 4 (residues 1 to 1337) CC GPRFLN| AUTHORS Gross,S., Knebel,A., Tenev,T., Neininger,A., Gaestel,M., CC GPRFLN| Herrlich,P. and Bohmer,F.D. CC GPRFLN| TITLE Inactivation of protein-tyrosine phosphatases as mechanism of CC GPRFLN| UV-induced signal transduction CC GPRFLN| JOURNAL J. Biol. Chem. 274 (37), 26378-26386 (1999) CC GPRFLN| MEDLINE 99403084 CC GPRFLN|REFERENCE 5 (residues 1 to 1337) CC GPRFLN| AUTHORS Tangye,S.G., Phillips,J.H., Lanier,L.L., de Vries,J.E. and CC GPRFLN| Aversa,G. CC GPRFLN| TITLE CD148: a receptor-type protein tyrosine phosphatase involved in the CC GPRFLN| regulation of human T cell activation CC GPRFLN| JOURNAL J. Immunol. 161 (7), 3249-3255 (1998) CC GPRFLN| MEDLINE 98430639 CC GPRFLN|REFERENCE 6 (residues 1 to 1337) CC GPRFLN| AUTHORS de la Fuente-Garcia,M.A., Nicolas,J.M., Freed,J.H., Palou,E., CC GPRFLN| Thomas,A.P., Vilella,R., Vives,J. and Gaya,A. CC GPRFLN| TITLE CD148 is a membrane protein tyrosine phosphatase present in all CC GPRFLN| hematopoietic lineages and is involved in signal transduction on CC GPRFLN| lymphocytes CC GPRFLN| JOURNAL Blood 91 (8), 2800-2809 (1998) CC GPRFLN| MEDLINE 98200586 CC GPRFLN|REFERENCE 7 (residues 1 to 1337) CC GPRFLN| AUTHORS Honda,H., Inazawa,J., Nishida,J., Yazaki,Y. and Hirai,H. CC GPRFLN| TITLE Molecular cloning, characterization, and chromosomal localization CC GPRFLN| of a novel protein-tyrosine phosphatase, HPTP eta CC GPRFLN| JOURNAL Blood 84 (12), 4186-4194 (1994) CC GPRFLN| MEDLINE 95086212 CC GPRFLN|REFERENCE 8 (residues 1 to 1337) CC GPRFLN| AUTHORS Ostman,A., Yang,Q. and Tonks,N.K. CC GPRFLN| TITLE Expression of DEP-1, a receptor-like protein-tyrosine-phosphatase, CC GPRFLN| is enhanced with increasing cell density CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 91 (21), 9680-9684 (1994) CC GPRFLN| MEDLINE 95024024 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 277 VNTIFKEY:269 FT PROTEIN 1 277 protein tyrosine phosphatase, receptor type, J polypeptide; human density enhanced phosphatase-1; CD148 antigen FT VNTIFKEY:270 FT CHAIN 1 277 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 277 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 277 AA; ENFEAYFKKQ QADSNCGFAE EYEDLKLVGI SQPKYAAELA ENRGKNRYNN VLPYDISRVK 60 LSVQTHSTDD YINANYMPGY HSKKDFIATQ GPLPNTLKDF WRMVWEKNVY AIIMLTKCVE 120 QGRTKCEEYW PSKQAQDYGD ITVAMTSEIV LPEWTIRDFT VKNIQTSESH PLRQFHFTSW 180 PDHGVPDTTD LLINFRYLVR DYMKQSPPES PILVHCSAGV GRTGTFIAID RLIYQIENEN 240 TVDVYGIVYD LRMHRPLMVQ TEDQYVFLNQ CVLDIVR 277 // ID hGLEPP1_D1\(NP_109592)\PTPRO STANDARD;PRT; 277 AA. AC NP_109592; DT 27-JUN-2003 DE receptor-type protein tyrosine phosphatase O isoform a precursor; glomerular epithelial protein-1; protein tyrosine phosphatase PTP-U2; phosphotyrosine phosphatase U2; PTPase U2; PTPROt [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from Z48541.1 and U20489.1. CC CC Summary: This gene encodes a receptor-type protein tyrosine CC phosphatase containing a single intracellular catalytic domain with CC a characteristic signature motif. The gene product, which has a CC transmembrane domain, is an integral membrane protein. Several CC alternatively spliced transcript variants, some of which encode CC different isoforms of the protein, have been described. These CC variants exhibit tissue-specific expression. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (a) known to date. The encoded protein has a large extracellular CC domain containing 8 repeats of a fibronectin type III-like motif. CC This variant is expressed in the glomerulus of kidney and in brain. CC In kidney, it may play a role in regulating glomerular epithelial CC cell (podocyte) structure and/or function. CC GPRFLN|REFERENCE 1 (residues 1 to 1216) CC GPRFLN| AUTHORS Aguiar,R.C., Yakushijin,Y., Kharbanda,S., Tiwari,S., Freeman,G.J. CC GPRFLN| and Shipp,M.A. CC GPRFLN| TITLE PTPROt: an alternatively spliced and developmentally regulated CC GPRFLN| B-lymphoid phosphatase that promotes G0/G1 arrest CC GPRFLN| JOURNAL Blood 94 (7), 2403-2413 (1999) CC GPRFLN| MEDLINE 99428326 CC GPRFLN|REFERENCE 2 (residues 1 to 1216) CC GPRFLN| AUTHORS Seimiya,H., Sawabe,T., Inazawa,J. and Tsuruo,T. CC GPRFLN| TITLE Cloning, expression and chromosomal localization of a novel gene CC GPRFLN| for protein tyrosine phosphatase (PTP-U2) induced by various CC GPRFLN| differentiation-inducing agents CC GPRFLN| JOURNAL Oncogene 10 (9), 1731-1738 (1995) CC GPRFLN| MEDLINE 95273089 CC GPRFLN|REFERENCE 3 (residues 1 to 1216) CC GPRFLN| AUTHORS Wiggins,R.C., Wiggins,J.E., Goyal,M., Wharram,B.L. and Thomas,P.E. CC GPRFLN| TITLE Molecular cloning of cDNAs encoding human GLEPP1, a membrane CC GPRFLN| protein tyrosine phosphatase: characterization of the GLEPP1 CC GPRFLN| protein distribution in human kidney and assignment of the GLEPP1 CC GPRFLN| gene to human chromosome 12p12-p13 CC GPRFLN| JOURNAL Genomics 27 (1), 174-181 (1995) CC GPRFLN| MEDLINE 95394455 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT REGION 17 272 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 FT DOMAIN 214 224 VNTIFKEY:1000; VNTINAME:Dom_Misc_3 SQ SEQUENCE 277 AA; DDFDAYIKDM AKDSDYKFSL QFEELKLIGL DIPHFAADLP LNRCKNRYTN ILPYDFSRVR 60 LVSMNEEEGA DYINANYIPG YNSPQEYIAT QGPLPETRND FWKMVLQQKS QIIVMLTQCN 120 EKRRVKCDHY WPFTEEPIAY GDITVEMISE EEQDDWACRH FRINYADEMQ DVMHFNYTAW 180 PDHGVPTANA AESILQFVHM VRQQATKSKG PMIIHCSAGV GRTGTFIALD RLLQHIRDHE 240 FVDILGLVSE MRSYRMSMVQ TEEQYIFIHQ CVQLMWM 277 // ID hHDPTP_D1\(NP_056281)\PTPN23 STANDARD;PRT; 286 AA. AC NP_056281; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 23; His-domain protein tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC PREDICTED REFSEQ: The mRNA record is supported by experimental CC evidence; however, the coding sequence is predicted. The reference CC sequence was derived from AF290614.1. CC GPRFLN|REFERENCE 1 (residues 1 to 1636) CC GPRFLN| AUTHORS Qu,X., Zhai,Y., Wei,H., Zhang,C., Xing,G., Lu,C., Wang,M. and He,F. CC GPRFLN| TITLE Cloning, chromosomal assignment and tissue expression of a novel CC GPRFLN| human protein tyrosine phosphatase (PTP-TD14) gene CC GPRFLN| JOURNAL I Chuan 23 (6), 1-9 (2001) CC GPRFLN|REFERENCE 2 (residues 1 to 1636) CC GPRFLN| AUTHORS Toyooka,S., Ouchida,M., Jitsumori,Y., Tsukuda,K., Sakai,A., CC GPRFLN| Nakamura,A., Shimizu,N. and Shimizu,K. CC GPRFLN| TITLE HD-PTP: A novel protein tyrosine phosphatase gene on human CC GPRFLN| chromosome 3p21.3 CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 278 (3), 671-678 (2000) CC GPRFLN| MEDLINE 20549011 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 286 VNTIFKEY:269 FT PROTEIN 1 286 His-domain protein tyrosine phosphatase FT VNTIFKEY:270 FT REGION 23 286 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 286 AA; ERLRQLQQEL EAFRGQLGDV GALDTVWREL QDAQEHDARG RSIAIARCYS LKNRHQDVMP 60 YDSNRVVLRS GKDDYINASC VEGLSPYCPP LVATQAPLPG TAADFWLMVH EQKVSVIVML 120 VSEAEMEKQK VARYFPTERG QPMVHGALSL ALSSVRSTET HVERVLSLQF RDQSLKRSLV 180 HLHFPTWPEL GLPDSPSNLL RFIQEVHAHY LHQRPLHTPI IVHCSSGVGR TGAFALLYAA 240 VQEVEAGNGI PELPQLVRRM RQQRKHMLQE KLHLRFCYEA VVRHVE 286 // ID hHePTP_D1\(NP_002823)\PTPN7 STANDARD;PRT; 273 AA. AC NP_002823; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 7 isoform 1; protein-tyrosine phoshatase, nonreceptor-type, stress induced; hematopoietic protein-tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from BC001746.1, BG340453.1, CC D11327.1 and M64322.1. CC On Jan 25, 2002 this sequence version replaced gi:4506299. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This gene is preferentially expressed in CC a variety of hematopoietic cells, and is an early response gene in CC lymphokine stimulated cells. The noncatalytic N-terminus of this CC PTP can interact with MAP kinases and suppress the MAP kinase CC activities. This PTP was shown to be involved in the regulation of CC T cell antigen receptor (TCR) signaling, which was thought to CC function through dephosphorylating the molecules related to MAP CC kinase pathway. Three alternatively spliced transcript variants of CC this gene, which encode two distinct isoforms, are reported. CC CC Transcript Variant: This variant (1) contains a different 5' CC region, which includes a part of the coding sequence when compared CC to variant 2. It thus encodes a protein that has a shorter CC N-terminus, as compared to isoform 2. CC GPRFLN|REFERENCE 1 (residues 1 to 360) CC GPRFLN| AUTHORS Oh-hora,M., Ogata,M., Mori,Y., Adachi,M., Imai,K., Kosugi,A. and CC GPRFLN| Hamaoka,T. CC GPRFLN| TITLE Direct suppression of TCR-mediated activation of extracellular CC GPRFLN| signal-regulated kinase by leukocyte protein tyrosine phosphatase, CC GPRFLN| a tyrosine-specific phosphatase CC GPRFLN| JOURNAL J. Immunol. 163 (3), 1282-1288 (1999) CC GPRFLN| MEDLINE 99343735 CC GPRFLN|REFERENCE 2 (residues 1 to 360) CC GPRFLN| AUTHORS Saxena,M., Williams,S., Brockdorff,J., Gilman,J. and Mustelin,T. CC GPRFLN| TITLE Inhibition of T cell signaling by mitogen-activated protein CC GPRFLN| kinase-targeted hematopoietic tyrosine phosphatase (HePTP) CC GPRFLN| JOURNAL J. Biol. Chem. 274 (17), 11693-11700 (1999) CC GPRFLN| MEDLINE 99223488 CC GPRFLN|REFERENCE 3 (residues 1 to 360) CC GPRFLN| AUTHORS Saxena,M., Williams,S., Gilman,J. and Mustelin,T. CC GPRFLN| TITLE Negative regulation of T cell antigen receptor signal transduction CC GPRFLN| by hematopoietic tyrosine phosphatase (HePTP) CC GPRFLN| JOURNAL J. Biol. Chem. 273 (25), 15340-15344 (1998) CC GPRFLN| MEDLINE 98288260 CC GPRFLN|REFERENCE 4 (residues 1 to 360) CC GPRFLN| AUTHORS Swieter,M., Berenstein,E.H., Swaim,W.D. and Siraganian,R.P. CC GPRFLN| TITLE Aggregation of IgE receptors in rat basophilic leukemia 2H3 cells CC GPRFLN| induces tyrosine phosphorylation of the cytosolic protein-tyrosine CC GPRFLN| phosphatase HePTP CC GPRFLN| JOURNAL J. Biol. Chem. 270 (37), 21902-21906 (1995) CC GPRFLN| MEDLINE 95394959 CC GPRFLN|REFERENCE 5 (residues 1 to 360) CC GPRFLN| AUTHORS Adachi,M., Sekiya,M., Isobe,M., Kumura,Y., Ogita,Z., Hinoda,Y., CC GPRFLN| Imai,K. and Yachi,A. CC GPRFLN| TITLE Molecular cloning and chromosomal mapping of a human CC GPRFLN| protein-tyrosine phosphatase LC-PTP CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 186 (3), 1607-1615 (1992) CC GPRFLN| MEDLINE 92378634 CC GPRFLN|REFERENCE 6 (residues 1 to 360) CC GPRFLN| AUTHORS Adachi,M., Sekiya,M., Arimura,Y., Takekawa,M., Itoh,F., Hinoda,Y., CC GPRFLN| Imai,K. and Yachi,A. CC GPRFLN| TITLE Protein-tyrosine phosphatase expression in pre-B cell NALM-6 CC GPRFLN| JOURNAL Cancer Res. 52 (3), 737-740 (1992) CC GPRFLN| MEDLINE 92119637 CC GPRFLN|REFERENCE 7 (sites) CC GPRFLN| AUTHORS Zanke,B., Suzuki,H., Kishihara,K., Mizzen,L., Minden,M., Pawson,A. CC GPRFLN| and Mak,T.W. CC GPRFLN| TITLE Cloning and expression of an inducible lymphoid-specific, protein CC GPRFLN| tyrosine phosphatase (HePTPase) CC GPRFLN| JOURNAL Eur. J. Immunol. 22 (1), 235-239 (1992) CC GPRFLN| MEDLINE 92111631 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 273 VNTIFKEY:269 FT PROTEIN 1 273 protein-tyrosine phoshatase, nonreceptor-type, stress induced; hematopoietic protein-tyrosine phosphatase FT VNTIFKEY:270 FT REGION 17 271 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 273 AA; HPLTRWALQR QPPSPKQLEE EFLKIPSNFV SPEDLDIPGH ASKDRYKTIL PNPQSRVCLG 60 RAQSQEDGDY INANYIRGYD GKEKVYIATQ GPMPNTVSDF WEMVWQEEVS LIVMLTQLRE 120 GKEKCVHYWP TEEETYGPFQ IRIQDMKECP EYTVRQLTIQ YQEERRSVKH ILFSAWPDHQ 180 TPESAGPLLR LVAEVEESPE TAAHPGPIVV HCSAGIGRTG CFIATRIGCQ QLKARGEVDI 240 LGIVCQLRLD RGGMIQTAEQ YQFLHHTLAL YAG 273 // ID hIA2_D1\(NP_002837)\PTPRN STANDARD;PRT; 279 AA. AC NP_002837; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, N precursor; islet cell antigen 2; islet cell antigen 512; islet cell autoantigen 3; protein tyrosine phosphatase-like N precursor [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L18983.1, AF042285.4 and CC BC007713.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and a single catalytic CC domain, and thus represents a receptor-type PTP. This PTP was found CC to be an autoantigen that is reactive with insulin-dependent CC diabetes mellitus (IDDM) patient sera, and thus may be a potential CC target of autoimmunity in diabetes mellitus. CC GPRFLN|REFERENCE 1 (residues 1 to 979) CC GPRFLN| AUTHORS Sanjeevi,C.B., Das,A.K. and Shtauvere-Brameus,A. CC GPRFLN| TITLE BCG vaccination and GAD65 and IA-2 autoantibodies in autoimmune CC GPRFLN| diabetes in southern India CC GPRFLN| JOURNAL Ann. N. Y. Acad. Sci. 958, 293-296 (2002) CC GPRFLN| MEDLINE 22015049 CC GPRFLN| REMARK GeneRIF: BCG vaccination and GAD65 and IA-2 autoantibodies in CC GPRFLN| autoimmune diabetes in southern India. CC GPRFLN|REFERENCE 2 (residues 1 to 979) CC GPRFLN| AUTHORS Kawasaki,E., Yamaguchi,H., Hattori,H., Egashira,T. and Eguchi,K. CC GPRFLN| TITLE Autoantibodies to IA-2 in type 1 diabetes: measurements with a new CC GPRFLN| enzyme-linked immunosorbent assay CC GPRFLN| JOURNAL Ann. N. Y. Acad. Sci. 958, 241-246 (2002) CC GPRFLN| MEDLINE 22015037 CC GPRFLN| REMARK GeneRIF: Autoantibodies to IA-2 in type 1 diabetes: measurements CC GPRFLN| with a new enzyme-linked immunosorbent assay. CC GPRFLN|REFERENCE 3 (residues 1 to 979) CC GPRFLN| AUTHORS Miao,D., Yu,L., Tiberti,C., Cuthbertson,D.D., Rewers,M., di CC GPRFLN| Mario,U., Eisenbarth,G.S. and Dotta,F. CC GPRFLN| TITLE ICA512(IA-2) epitope specific assays distinguish transient from CC GPRFLN| diabetes associated autoantibodies CC GPRFLN| JOURNAL J. Autoimmun. 18 (2), 191-196 (2002) CC GPRFLN| MEDLINE 21906940 CC GPRFLN| REMARK GeneRIF: ICA512(IA-2) epitope specific assays distinguish transient CC GPRFLN| from diabetes associated autoantibodies. CC GPRFLN|REFERENCE 4 (residues 1 to 979) CC GPRFLN| AUTHORS Mikulecky,M. and Michalkova,D. CC GPRFLN| TITLE Secular and seasonal cycling of IA2-ab autoantibody in Slovak CC GPRFLN| diabetic children CC GPRFLN| JOURNAL Biomed. Pharmacother. 55 Suppl 1, 106S-109S (2001) CC GPRFLN| MEDLINE 21630621 CC GPRFLN|REFERENCE 5 (residues 1 to 979) CC GPRFLN| AUTHORS Cui,L., Yu,W.P., DeAizpurua,H.J., Schmidli,R.S. and Pallen,C.J. CC GPRFLN| TITLE Cloning and characterization of islet cell antigen-related CC GPRFLN| protein-tyrosine phosphatase (PTP), a novel receptor-like PTP and CC GPRFLN| autoantigen in insulin-dependent diabetes CC GPRFLN| JOURNAL J. Biol. Chem. 271 (40), 24817-24823 (1996) CC GPRFLN| MEDLINE 96394649 CC GPRFLN|REFERENCE 6 (residues 1 to 979) CC GPRFLN| AUTHORS van den Maagdenberg,A.M., Olde Weghuis,D., Rijss,J., van de CC GPRFLN| Wetering,R.A., Wieringa,B., Geurts van Kessel,A. and Hendriks,W.J. CC GPRFLN| TITLE Assignment of the human gene for receptor-type protein tyrosine CC GPRFLN| phosphatase IA-2 (PTPRN) to chromosome region 2q35 --> q36.1 and CC GPRFLN| identification of an intragenic genetic marker CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 73 (1-2), 145-148 (1996) CC GPRFLN| MEDLINE 96244610 CC GPRFLN|REFERENCE 7 (residues 1 to 979) CC GPRFLN| AUTHORS Lan,M.S., Lu,J., Goto,Y. and Notkins,A.L. CC GPRFLN| TITLE Molecular cloning and identification of a receptor-type protein CC GPRFLN| tyrosine phosphatase, IA-2, from human insulinoma CC GPRFLN| JOURNAL DNA Cell Biol. 13 (5), 505-514 (1994) CC GPRFLN| MEDLINE 94296553 CC GPRFLN|REFERENCE 8 (residues 1 to 979) CC GPRFLN| AUTHORS Rabin,D.U., Pleasic,S.M., Shapiro,J.A., Yoo-Warren,H., Oles,J., CC GPRFLN| Hicks,J.M., Goldstein,D.E. and Rae,P.M. CC GPRFLN| TITLE Islet cell antigen 512 is a diabetes-specific islet autoantigen CC GPRFLN| related to protein tyrosine phosphatases CC GPRFLN| JOURNAL J. Immunol. 152 (6), 3183-3188 (1994) CC GPRFLN| MEDLINE 94194080 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 islet cell antigen 2; islet cell antigen 512; islet cell autoantigen 3; protein tyrosine phosphatase-like N precursor FT VNTIFKEY:270 FT CHAIN 1 279 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 278 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; HMILAYMEDH LRNRDRLAKE WQALCAYQAE PNTCATAQGE GNIKKNRHPD FLPYDHARIK 60 LKVESSPSRS DYINASPIIE HDPRMPAYIA TQGPLSHTIA DFWQMVWESG CTVIVMLTPL 120 VEDGVKQCDR YWPDEGASLY HVYEVNLVSE HIWCEDFLVR SFYLKNVQTQ ETRTLTQFHF 180 LSWPAEGTPA STRPLLDFRR KVNKCYRGRS CPIIVHCSDG AGRTGTYILI DMVLNRMAKG 240 VKEIDIAATL EHVRDQRPGL VRSKDQFEFA LTAVAEEVN 279 // ID hIA2beta_D1\(NP_002838)\PTPRN2 STANDARD;PRT; 279 AA. AC NP_002838; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, N polypeptide 2 isoform 1 precursor; protein tyrosine phosphatase receptor pi; phogrin; tyrosine phosphatase IA-2 beta; IAR/receptor-like protein-tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from U66702.1 and AF007555.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and a single intracellular CC catalytic domain, and thus represents a receptor-type PTP. The CC catalytic domain of this PTP is most closely related to CC PTPRN/IA-2beta. This PTP and PTPRN are both found to be major CC autoantigens associated with insulin-dependent diabetes mellitus. CC Three alternatively spliced transcript variants of this gene, which CC encode distinct proteins, have been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1015) CC GPRFLN| AUTHORS van den Maagdenberg,A.M., Schepens,J.T., Schepens,M.T., Pepers,B., CC GPRFLN| Wieringa,B., van Kessel,A.G. and Hendriks,W.J. CC GPRFLN| TITLE Assignment of Ptprn2, the gene encoding receptor-type protein CC GPRFLN| tyrosine phosphatase IA-2beta, a major autoantigen in CC GPRFLN| insulin-dependent diabetes mellitus, to mouse chromosome region 12F CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 82 (3-4), 153-155 (1998) CC GPRFLN| MEDLINE 99077744 CC GPRFLN|REFERENCE 2 (residues 1 to 1015) CC GPRFLN| AUTHORS Schmidli,R.S., Colman,P.G., Cui,L., Yu,W.P., Kewming,K., CC GPRFLN| Jankulovski,C., Harrison,L.C., Pallen,C.J. and DeAizpurua,H.J. CC GPRFLN| TITLE Antibodies to the protein tyrosine phosphatases IAR and IA-2 are CC GPRFLN| associated with progression to insulin-dependent diabetes (IDDM) in CC GPRFLN| first-degree relatives at-risk for IDDM CC GPRFLN| JOURNAL Autoimmunity 28 (1), 15-23 (1998) CC GPRFLN| MEDLINE 98425805 CC GPRFLN|REFERENCE 3 (residues 1 to 1015) CC GPRFLN| AUTHORS Li,Q., Borovitskaya,A.E., DeSilva,M.G., Wasserfall,C., CC GPRFLN| Maclaren,N.K., Notkins,A.L. and Lan,M.S. CC GPRFLN| TITLE Autoantigens in insulin-dependent diabetes mellitus: molecular CC GPRFLN| cloning and characterization of human IA-2 beta CC GPRFLN| JOURNAL Proc. Assoc. Am. Physicians 109 (4), 429-439 (1997) CC GPRFLN| MEDLINE 97364262 CC GPRFLN|REFERENCE 4 (residues 1 to 1015) CC GPRFLN| AUTHORS Smith,P.D., Barker,K.T., Wang,J., Lu,Y.J., Shipley,J. and CC GPRFLN| Crompton,M.R. CC GPRFLN| TITLE ICAAR, a novel member of a new family of transmembrane, tyrosine CC GPRFLN| phosphatase-like proteins CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 229 (2), 402-411 (1996) CC GPRFLN| MEDLINE 97127415 CC GPRFLN|REFERENCE 5 (residues 1 to 1015) CC GPRFLN| AUTHORS Kawasaki,E., Hutton,J.C. and Eisenbarth,G.S. CC GPRFLN| TITLE Molecular cloning and characterization of the human transmembrane CC GPRFLN| protein tyrosine phosphatase homologue, phogrin, an autoantigen of CC GPRFLN| type 1 diabetes CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 227 (2), 440-447 (1996) CC GPRFLN| MEDLINE 97032784 CC GPRFLN|REFERENCE 6 (residues 1 to 1015) CC GPRFLN| AUTHORS Cui,L., Yu,W.P., DeAizpurua,H.J., Schmidli,R.S. and Pallen,C.J. CC GPRFLN| TITLE Cloning and characterization of islet cell antigen-related CC GPRFLN| protein-tyrosine phosphatase (PTP), a novel receptor-like PTP and CC GPRFLN| autoantigen in insulin-dependent diabetes CC GPRFLN| JOURNAL J. Biol. Chem. 271 (40), 24817-24823 (1996) CC GPRFLN| MEDLINE 96394649 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 protein tyrosine phosphatase receptor pi; phogrin; tyrosine phosphatase IA-2 beta; IAR/receptor-like protein-tyrosine phosphatase FT VNTIFKEY:270 FT CHAIN 1 279 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 278 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; HMILSYMEDH LKNKNRLEKE WEALCAYQAE PNSSFVAQRE ENVPKNRSLA VLTYDHSRVL 60 LKAENSHSHS DYINASPIMD HDPRNPAYIA TQGPLPATVA DFWQMVWESG CVVIVMLTPL 120 AENGVRQCYH YWPDEGSNLY HIYEVNLVSE HIWCEDFLVR SFYLKNLQTN ETRTVTQFHF 180 LSWYDRGVPS SSRSLLDFRR KVNKCYRGRS CPIIVHCSDG AGRSGTYVLI DMVLNKMAKG 240 AKEIDIAATL EHLRDQRPGM VQTKEQFEFA LTAVAEEVN 279 // ID hLAR_D1\(NP_002831)\PTPRF STANDARD;PRT; 275 AA. AC NP_002831; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, F isoform 1 precursor; protein tyrosine phosphatase, receptor type, F polypeptide; receptor-linked protein-tyrosine phosphatase LAR; leukocyte antigen-related tyrosine phosphatase; LCA-homolog [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from Y00815.1 and BI711143.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. The extracellular region contains three Ig-like CC domains, and nine non-Ig like domains similar to that of CC neural-cell adhesion molecule. This PTP was shown to function in CC the regulation of epithelial cell-cell contacts at adherents CC junctions, as well as in the control of beta-catenin signaling. An CC increased expression level of this protein was found in the CC insulin-responsive tissue of obese, insulin-resistant individuals, CC and may contribute to the pathogenesis of insulin resistance. Two CC alternatively spliced transcript variants of this gene, which CC encode distinct proteins, have been reported. CC CC Transcript Variant: This variant (1) contains an extra internal CC fragment within the coding region when compared to variant 2. It CC thus encodes a protein that has a 9 aa internal fragment absent in CC isoform 2. CC GPRFLN|REFERENCE 1 (residues 1 to 1897) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1897) CC GPRFLN| AUTHORS Symons,J.R., LeVea,C.M. and Mooney,R.A. CC GPRFLN| TITLE Expression of the leucocyte common antigen-related (LAR) tyrosine CC GPRFLN| phosphatase is regulated by cell density through functional CC GPRFLN| E-cadherin complexes CC GPRFLN| JOURNAL Biochem. J. 365 (Pt 2), 513-519 (2002) CC GPRFLN| MEDLINE 22090243 CC GPRFLN| REMARK GeneRIF: regulation of expression by cell density through CC GPRFLN| functional E-cadherin complexes CC GPRFLN|REFERENCE 3 (residues 1 to 1897) CC GPRFLN| AUTHORS Zabolotny,J.M., Kim,Y.B., Peroni,O.D., Kim,J.K., Pani,M.A., CC GPRFLN| Boss,O., Klaman,L.D., Kamatkar,S., Shulman,G.I., Kahn,B.B. and CC GPRFLN| Neel,B.G. CC GPRFLN| TITLE Overexpression of the LAR (leukocyte antigen-related) CC GPRFLN| protein-tyrosine phosphatase in muscle causes insulin resistance CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 98 (9), 5187-5192 (2001) CC GPRFLN| MEDLINE 21221100 CC GPRFLN|REFERENCE 4 (residues 1 to 1897) CC GPRFLN| AUTHORS Muller,T., Choidas,A., Reichmann,E. and Ullrich,A. CC GPRFLN| TITLE Phosphorylation and free pool of beta-catenin are regulated by CC GPRFLN| tyrosine kinases and tyrosine phosphatases during epithelial cell CC GPRFLN| migration CC GPRFLN| JOURNAL J. Biol. Chem. 274 (15), 10173-10183 (1999) CC GPRFLN| MEDLINE 99214576 CC GPRFLN|REFERENCE 5 (residues 1 to 1897) CC GPRFLN| AUTHORS Ahmad,F. and Goldstein,B.J. CC GPRFLN| TITLE Functional association between the insulin receptor and the CC GPRFLN| transmembrane protein-tyrosine phosphatase LAR in intact cells CC GPRFLN| JOURNAL J. Biol. Chem. 272 (1), 448-457 (1997) CC GPRFLN| MEDLINE 97150746 CC GPRFLN|REFERENCE 6 (residues 1 to 1897) CC GPRFLN| AUTHORS Harder,K.W., Saw,J., Miki,N. and Jirik,F. CC GPRFLN| TITLE Coexisting amplifications of the chromosome 1p32 genes (PTPRF and CC GPRFLN| MYCL1) encoding protein tyrosine phosphatase LAR and L-myc in a CC GPRFLN| small cell lung cancer line CC GPRFLN| JOURNAL Genomics 27 (3), 552-553 (1995) CC GPRFLN| MEDLINE 96047346 CC GPRFLN|REFERENCE 7 (residues 1 to 1897) CC GPRFLN| AUTHORS Schaapveld,R.Q., van den Maagdenberg,A.M., Schepens,J.T., CC GPRFLN| Weghuis,D.O., Geurts van Kessel,A., Wieringa,B. and Hendriks,W.J. CC GPRFLN| TITLE The mouse gene Ptprf encoding the leukocyte common antigen-related CC GPRFLN| molecule LAR: cloning, characterization, and chromosomal CC GPRFLN| localization CC GPRFLN| JOURNAL Genomics 27 (1), 124-130 (1995) CC GPRFLN| MEDLINE 95394448 CC GPRFLN|REFERENCE 8 (residues 1 to 1897) CC GPRFLN| AUTHORS O'Grady,P., Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Genomic organization of the human LAR protein tyrosine phosphatase CC GPRFLN| gene and alternative splicing in the extracellular fibronectin CC GPRFLN| type-III domains CC GPRFLN| JOURNAL J. Biol. Chem. 269 (40), 25193-25199 (1994) CC GPRFLN| MEDLINE 95014301 CC GPRFLN|REFERENCE 9 (residues 1 to 1897) CC GPRFLN| AUTHORS Streuli,M., Krueger,N.X., Hall,L.R., Schlossman,S.F. and Saito,H. CC GPRFLN| TITLE A new member of the immunoglobulin superfamily that has a CC GPRFLN| cytoplasmic region homologous to the leukocyte common antigen CC GPRFLN| JOURNAL J. Exp. Med. 168 (5), 1523-1530 (1988) CC GPRFLN| MEDLINE 89035978 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 protein tyrosine phosphatase, receptor type, F polypeptide; receptor-linked protein-tyrosine phosphatase LAR; leukocyte antigen-related tyrosine phosphatase; LCA-homolog FT VNTIFKEY:270 FT CHAIN 1 275 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 272 PTPc FT VNTIFKEY:266; VNTINAME:Region_4 SQ SEQUENCE 275 AA; TDLADNIERL KANDGLKFSQ EYESIDPGQQ FTWENSNLEV NKPKNRYANV IAYDHSRVIL 60 TSIDGVPGSD YINANYIDGY RKQNAYIATQ GPLPETMGDF WRMVWEQRTA TVVMMTRLEE 120 KSRVKCDQYW PARGTETCGL IQVTLLDTVE LATYTVRTFA LHKSGSSEKR ELRQFQFMAW 180 PDHGVPEYPT PILAFLRRVK ACNPLDAGPM VVHCSAGVGR TGCFIVIDAM LERMKHEKTV 240 DIYGHVTCMR SQRNYMVQTE DQYVFIHEAL LEAAT 275 // ID hLAR_D2\(NP_002831)\PTPRF STANDARD;PRT; 283 AA. AC NP_002831; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, F isoform 1 precursor; protein tyrosine phosphatase, receptor type, F polypeptide; receptor-linked protein-tyrosine phosphatase LAR; leukocyte antigen-related tyrosine phosphatase; LCA-homolog [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from Y00815.1 and BI711143.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. The extracellular region contains three Ig-like CC domains, and nine non-Ig like domains similar to that of CC neural-cell adhesion molecule. This PTP was shown to function in CC the regulation of epithelial cell-cell contacts at adherents CC junctions, as well as in the control of beta-catenin signaling. An CC increased expression level of this protein was found in the CC insulin-responsive tissue of obese, insulin-resistant individuals, CC and may contribute to the pathogenesis of insulin resistance. Two CC alternatively spliced transcript variants of this gene, which CC encode distinct proteins, have been reported. CC CC Transcript Variant: This variant (1) contains an extra internal CC fragment within the coding region when compared to variant 2. It CC thus encodes a protein that has a 9 aa internal fragment absent in CC isoform 2. CC GPRFLN|REFERENCE 1 (residues 1 to 1897) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1897) CC GPRFLN| AUTHORS Symons,J.R., LeVea,C.M. and Mooney,R.A. CC GPRFLN| TITLE Expression of the leucocyte common antigen-related (LAR) tyrosine CC GPRFLN| phosphatase is regulated by cell density through functional CC GPRFLN| E-cadherin complexes CC GPRFLN| JOURNAL Biochem. J. 365 (Pt 2), 513-519 (2002) CC GPRFLN| MEDLINE 22090243 CC GPRFLN| REMARK GeneRIF: regulation of expression by cell density through CC GPRFLN| functional E-cadherin complexes CC GPRFLN|REFERENCE 3 (residues 1 to 1897) CC GPRFLN| AUTHORS Zabolotny,J.M., Kim,Y.B., Peroni,O.D., Kim,J.K., Pani,M.A., CC GPRFLN| Boss,O., Klaman,L.D., Kamatkar,S., Shulman,G.I., Kahn,B.B. and CC GPRFLN| Neel,B.G. CC GPRFLN| TITLE Overexpression of the LAR (leukocyte antigen-related) CC GPRFLN| protein-tyrosine phosphatase in muscle causes insulin resistance CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 98 (9), 5187-5192 (2001) CC GPRFLN| MEDLINE 21221100 CC GPRFLN|REFERENCE 4 (residues 1 to 1897) CC GPRFLN| AUTHORS Muller,T., Choidas,A., Reichmann,E. and Ullrich,A. CC GPRFLN| TITLE Phosphorylation and free pool of beta-catenin are regulated by CC GPRFLN| tyrosine kinases and tyrosine phosphatases during epithelial cell CC GPRFLN| migration CC GPRFLN| JOURNAL J. Biol. Chem. 274 (15), 10173-10183 (1999) CC GPRFLN| MEDLINE 99214576 CC GPRFLN|REFERENCE 5 (residues 1 to 1897) CC GPRFLN| AUTHORS Ahmad,F. and Goldstein,B.J. CC GPRFLN| TITLE Functional association between the insulin receptor and the CC GPRFLN| transmembrane protein-tyrosine phosphatase LAR in intact cells CC GPRFLN| JOURNAL J. Biol. Chem. 272 (1), 448-457 (1997) CC GPRFLN| MEDLINE 97150746 CC GPRFLN|REFERENCE 6 (residues 1 to 1897) CC GPRFLN| AUTHORS Harder,K.W., Saw,J., Miki,N. and Jirik,F. CC GPRFLN| TITLE Coexisting amplifications of the chromosome 1p32 genes (PTPRF and CC GPRFLN| MYCL1) encoding protein tyrosine phosphatase LAR and L-myc in a CC GPRFLN| small cell lung cancer line CC GPRFLN| JOURNAL Genomics 27 (3), 552-553 (1995) CC GPRFLN| MEDLINE 96047346 CC GPRFLN|REFERENCE 7 (residues 1 to 1897) CC GPRFLN| AUTHORS Schaapveld,R.Q., van den Maagdenberg,A.M., Schepens,J.T., CC GPRFLN| Weghuis,D.O., Geurts van Kessel,A., Wieringa,B. and Hendriks,W.J. CC GPRFLN| TITLE The mouse gene Ptprf encoding the leukocyte common antigen-related CC GPRFLN| molecule LAR: cloning, characterization, and chromosomal CC GPRFLN| localization CC GPRFLN| JOURNAL Genomics 27 (1), 124-130 (1995) CC GPRFLN| MEDLINE 95394448 CC GPRFLN|REFERENCE 8 (residues 1 to 1897) CC GPRFLN| AUTHORS O'Grady,P., Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Genomic organization of the human LAR protein tyrosine phosphatase CC GPRFLN| gene and alternative splicing in the extracellular fibronectin CC GPRFLN| type-III domains CC GPRFLN| JOURNAL J. Biol. Chem. 269 (40), 25193-25199 (1994) CC GPRFLN| MEDLINE 95014301 CC GPRFLN|REFERENCE 9 (residues 1 to 1897) CC GPRFLN| AUTHORS Streuli,M., Krueger,N.X., Hall,L.R., Schlossman,S.F. and Saito,H. CC GPRFLN| TITLE A new member of the immunoglobulin superfamily that has a CC GPRFLN| cytoplasmic region homologous to the leukocyte common antigen CC GPRFLN| JOURNAL J. Exp. Med. 168 (5), 1523-1530 (1988) CC GPRFLN| MEDLINE 89035978 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein tyrosine phosphatase, receptor type, F polypeptide; receptor-linked protein-tyrosine phosphatase LAR; leukocyte antigen-related tyrosine phosphatase; LCA-homolog FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 25 282 PTPc FT VNTIFKEY:266; VNTINAME:Region_5 SQ SEQUENCE 283 AA; RNLYAHIQKL GQVPPGESVT AMELEFKLLA SSKAHTSRFI SANLPCNKFK NRLVNIMPYE 60 LTRVCLQPIR GVEGSDYINA SFLDGYRQQK AYIATQGPLA ESTEDFWRML WEHNSTIIVM 120 LTKLREMGRE KCHQYWPAER SARYQYFVVD PMAEYNMPQY ILREFKVTDA RDGQSRTIRQ 180 FQFTDWPEQG VPKTGEGFID FIGQVHKTKE QFGQDGPITV HCSAGVGRTG VFITLSIVLE 240 RMRYEGVVDM FQTVKTLRTQ RPAMVQTEDQ YQLCYRAALE YLG 283 // ID hLyPTP_D1\(NP_057051)\PTPN22 STANDARD;PRT; 287 AA. AC NP_057051; DT 30-JUN-2003 DE lymphoid-specific protein tyrosine phosphatase isoform 1; lymphoid-specific protein tyrosine phosphatase; protein tyrosine phosphatase homolog [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from AF077031.1 and AF001846.1. CC CC Summary: This gene encodes a protein tyrosine phosphatase which is CC expressed primarily in lymphoid tissues. This enzyme associates CC with the molecular adapter protein CBL and may be involved in CC regulating CBL function in the T-cell receptor signaling pathway. CC Alternative splicing of this gene results in two transcript CC variants encoding distinct isoforms. CC CC Transcript Variant: This variant (1) encodes the longer isoform (1) CC which is 116 aa longer than isoform 2 and has a distinct CC C-terminus. CC GPRFLN|REFERENCE 1 (residues 1 to 807) CC GPRFLN| AUTHORS Hill,R.J., Zozulya,S., Lu,Y.L., Ward,K., Gishizky,M. and Jallal,B. CC GPRFLN| TITLE The lymphoid protein tyrosine phosphatase Lyp interacts with the CC GPRFLN| adaptor molecule Grb2 and functions as a negative regulator of CC GPRFLN| T-cell activation CC GPRFLN| JOURNAL Exp. Hematol. 30 (3), 237-244 (2002) CC GPRFLN| MEDLINE 21876996 CC GPRFLN| REMARK GeneRIF: data demonstrate a novel interaction between Lyp and the CC GPRFLN| adaptor Grb2 and are consistent with a negative regulatory role for CC GPRFLN| Lyp in T-cell signaling. CC GPRFLN|REFERENCE 2 (residues 1 to 807) CC GPRFLN| AUTHORS Cohen,S., Dadi,H., Shaoul,E., Sharfe,N. and Roifman,C.M. CC GPRFLN| TITLE Cloning and characterization of a lymphoid-specific, inducible CC GPRFLN| human protein tyrosine phosphatase, Lyp CC GPRFLN| JOURNAL Blood 93 (6), 2013-2024 (1999) CC GPRFLN| MEDLINE 99168989 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 287 VNTIFKEY:269 FT PROTEIN 1 287 lymphoid-specific protein tyrosine phosphatase; protein tyrosine phosphatase homolog FT VNTIFKEY:270 FT REGION 20 287 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 287 AA; EILQKFLDEA QSKKITKEEF ANEFLKLKRQ STKYKADKTY PTTVAEKPKN IKKNRYKDIL 60 PYDYSRVELS LITSDEDSSY INANFIKGVY GPKAYIATQG PLSTTLLDFW RMIWEYSVLI 120 IGMACMEYEM GKKKCERYWA EPVEMQLEFG PFSVSCEAEK RKSDYIIRTL KVKFNSETRT 180 IYQFHYKNWP DHDVPSSIDP ILELIWDVRC YQEDDSVPIC IHCSAGCGRT GVICAIDYTW 240 MLLKDGIIPE NFSVFSLIRE MRTQRPSLVQ TQEQYELVYN AVLELFK 287 // ID hMEG1_D1\(NP_002821)\PTPN4 STANDARD;PRT; 277 AA. AC NP_002821; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 4; megakaryocyte phosphatase; PTPase-MEG1; protein tyrosine phosphatase MEG1; megakaryocyte protein-tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M68941.1 and BC010674.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This protein contains a C-terminal PTP CC domain and an N-terminal domain homologous to the band 4.1 CC superfamily of cytoskeletal-associated proteins. This PTP has been CC shown to interact with glutamate receptor delta 2 and epsilon CC subunits, and is thought to play a role in signalling downstream of CC the glutamate receptors through tyrosine dephosphorylation. CC GPRFLN|REFERENCE 1 (residues 1 to 926) CC GPRFLN| AUTHORS Hironaka,K., Umemori,H., Tezuka,T., Mishina,M. and Yamamoto,T. CC GPRFLN| TITLE The protein-tyrosine phosphatase PTPMEG interacts with glutamate CC GPRFLN| receptor delta 2 and epsilon subunits CC GPRFLN| JOURNAL J. Biol. Chem. 275 (21), 16167-16173 (2000) CC GPRFLN| MEDLINE 20283654 CC GPRFLN|REFERENCE 2 (residues 1 to 926) CC GPRFLN| AUTHORS Gu,M., Meng,K. and Majerus,P.W. CC GPRFLN| TITLE The effect of overexpression of the protein tyrosine phosphatase CC GPRFLN| PTPMEG on cell growth and on colony formation in soft agar in COS-7 CC GPRFLN| cells CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (23), 12980-12985 (1996) CC GPRFLN| MEDLINE 97075104 CC GPRFLN|REFERENCE 3 (residues 1 to 926) CC GPRFLN| AUTHORS Gu,M. and Majerus,P.W. CC GPRFLN| TITLE The properties of the protein tyrosine phosphatase PTPMEG CC GPRFLN| JOURNAL J. Biol. Chem. 271 (44), 27751-27759 (1996) CC GPRFLN| MEDLINE 97066967 CC GPRFLN|REFERENCE 4 (residues 1 to 926) CC GPRFLN| AUTHORS Gu,M.X., York,J.D., Warshawsky,I. and Majerus,P.W. CC GPRFLN| TITLE Identification, cloning, and expression of a cytosolic CC GPRFLN| megakaryocyte protein-tyrosine-phosphatase with sequence homology CC GPRFLN| to cytoskeletal protein 4.1 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (13), 5867-5871 (1991) CC GPRFLN| MEDLINE 91288564 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 277 VNTIFKEY:269 FT PROTEIN 1 277 megakaryocyte phosphatase; PTPase-MEG1; protein tyrosine phosphatase MEG1; megakaryocyte protein-tyrosine phosphatase FT VNTIFKEY:270 FT REGION 19 277 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 277 AA; HSLRESMIQL AEGLITGTVL TQFDQLYRKK PGMTMSCAKL PQNISKNRYR DISPYDATRV 60 ILKGNEDYIN ANYINMEIPS SSIINQYIAC QGPLPHTCTD FWQMTWEQGS SMVVMLTTQV 120 ERGRVKCHQY WPEPTGSSSY GCYQVTCHSE EGNTAYIFRK MTLFNQEKNE SRPLTQIQYI 180 AWPDHGVPDD SSDFLDFVCH VRNKRAGKEE PVVVHCSAGI GRTGVLITME TAMCLIECNQ 240 PVYPLDIVRT MRDQRAMMIQ TPSQYRFVCE AILKVYE 277 // ID hMEG2_D1\(NP_002824)\PTPN9 STANDARD;PRT; 291 AA. AC NP_002824; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 9; protein-tyrosine phosphatase MEG2; PTPase-MEG2 [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M83738.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an N-terminal domain CC that shares a significant similarity with yeast SEC14, which is a CC protein that has phosphatidylinositol transfer activity and is CC required for protein secretion through the Golgi complex in yeast. CC This PTP was found to be activated by polyphosphoinositide, and is CC thought to be involved in signaling events regulating phagocytosis. CC GPRFLN|REFERENCE 1 (residues 1 to 593) CC GPRFLN| AUTHORS Qi,Y., Zhao,R., Cao,H., Sui,X., Krantz,S.B. and Zhao,Z.J. CC GPRFLN| TITLE Purification and characterization of protein tyrosine phosphatase CC GPRFLN| PTP-MEG2 CC GPRFLN| JOURNAL J. Cell. Biochem. 86 (1), 79-89 (2002) CC GPRFLN| MEDLINE 22106294 CC GPRFLN| REMARK GeneRIF: Purification and characterization of protein tyrosine CC GPRFLN| phosphatase PTP-MEG2 CC GPRFLN|REFERENCE 2 (residues 1 to 593) CC GPRFLN| AUTHORS Kruger,J.M., Fukushima,T., Cherepanov,V., Borregaard,N., Loeve,C., CC GPRFLN| Shek,C., Sharma,K., Tanswell,A.K., Chow,C.W. and Downey,G.P. CC GPRFLN| TITLE Protein-tyrosine phosphatase MEG2 is expressed by human CC GPRFLN| neutrophils. Localization to the phagosome and activation by CC GPRFLN| polyphosphoinositides CC GPRFLN| JOURNAL J. Biol. Chem. 277 (4), 2620-2628 (2002) CC GPRFLN| MEDLINE 21659736 CC GPRFLN|REFERENCE 3 (residues 1 to 593) CC GPRFLN| AUTHORS Gu,M., Warshawsky,I. and Majerus,P.W. CC GPRFLN| TITLE Cloning and expression of a cytosolic megakaryocyte CC GPRFLN| protein-tyrosine-phosphatase with sequence homology to CC GPRFLN| retinaldehyde-binding protein and yeast SEC14p CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (7), 2980-2984 (1992) CC GPRFLN| MEDLINE 92212952 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 291 VNTIFKEY:269 FT PROTEIN 1 291 protein-tyrosine phosphatase MEG2; PTPase-MEG2 FT VNTIFKEY:270 FT REGION 17 291 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 291 AA; MTIQELVDYV NARQKQGIYE EYEDIRRENP VGTFHCSMSP GNLEKNRYGD VPCLDQTRVK 60 LTKRSGHTQT DYINASFMDG YKQKNAYIGT QGPLENTYRD FWLMVWEQKV LVIVMTTRFE 120 EGGRRKCGQY WPLEKDSRIR FGFLTVTNLG VENMNHYKKT TLEIHNTEER QKRQVTHFQF 180 LSWPDYGVPS SAASLIDFLR VVRNQQSLAV SNMGARSKGQ CPEPPIVVHC SAGIGRTGTF 240 CSLDICLAQL EELGTLNVFQ TVSRMRTQRA FSIQTPEQYY FCYKAILEFA E 291 // ID hPCPTP1_D1\(NP_002840)\PTPRR STANDARD;PRT; 275 AA. AC NP_002840; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, R isoform 1 precursor; protein tyrosine phosphatase, receptor type, Q; protein-tyrosine phosphatase NC-PTPCOM1; protein tyrosine phosphatase Cr1PTPase precursor; Ch-1 PTPase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from D64053.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and a single intracellular CC catalytic domains, and thus represents a receptor-type PTP. The CC similar gene predominately expressed in mouse brain was found to CC associate with, and thus regulate the activity and cellular CC localization of MAP kinases. The rat counterpart of this gene was CC reported to be regulated by the nerve growth factor, which CC suggested the function of this gene in neuronal growth and CC differentiation. CC CC Transcript Variant: This variant (1) contains a different 5' end CC region when compared to variant 2. It thus encodes a protein that CC has a longer N-terminus, as compared to isoform 2. CC GPRFLN|REFERENCE 1 (residues 1 to 657) CC GPRFLN| AUTHORS Blanco-Aparicio,C., Torres,J. and Pulido,R. CC GPRFLN| TITLE A novel regulatory mechanism of MAP kinases activation and nuclear CC GPRFLN| translocation mediated by PKA and the PTP-SL tyrosine phosphatase CC GPRFLN| JOURNAL J. Cell Biol. 147 (6), 1129-1136 (1999) CC GPRFLN| MEDLINE 20069779 CC GPRFLN|REFERENCE 2 (residues 1 to 657) CC GPRFLN| AUTHORS Shiozuka,K., Watanabe,Y., Ikeda,T., Hashimoto,S. and Kawashima,H. CC GPRFLN| TITLE Cloning and expression of PCPTP1 encoding protein tyrosine CC GPRFLN| phosphatase CC GPRFLN| JOURNAL Gene 162 (2), 279-284 (1995) CC GPRFLN| MEDLINE 96032358 CC GPRFLN| REMARK founctional study of the rat homolog CC GPRFLN|REFERENCE 3 (residues 1 to 657) CC GPRFLN| AUTHORS Ogata,M., Sawada,M., Fujino,Y. and Hamaoka,T. CC GPRFLN| TITLE cDNA cloning and characterization of a novel receptor-type protein CC GPRFLN| tyrosine phosphatase expressed predominantly in the brain CC GPRFLN| JOURNAL J. Biol. Chem. 270 (5), 2337-2343 (1995) CC GPRFLN| MEDLINE 95138207 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 4 (residues 1 to 657) CC GPRFLN| AUTHORS Sharma,E. and Lombroso,P.J. CC GPRFLN| TITLE A neuronal protein tyrosine phosphatase induced by nerve growth CC GPRFLN| factor CC GPRFLN| JOURNAL J. Biol. Chem. 270 (1), 49-53 (1995) CC GPRFLN| MEDLINE 95113874 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 protein tyrosine phosphatase, receptor type, Q; protein-tyrosine phosphatase NC-PTPCOM1; protein tyrosine phosphatase Cr1PTPase precursor; Ch-1 PTPase FT VNTIFKEY:270 FT CHAIN 1 275 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 18 273 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 275 AA; SRILTRSQLR DVVASSHLLQ SEFMEIPMNF VDPKEIDIPR HGTKNRYKTI LPNPLSRVCL 60 RPKNVTDSLS TYINANYIRG YSGKEKAFIA TQGPMINTVD DFWQMVWQED SPVIVMITKL 120 KEKNEKCVLY WPEKRGIYGK VEVLVISVNE CDNYTIRNLV LKQGSHTQHV KHYWYTSWPD 180 HKTPDSAQPL LQLMLDVEED RLASQGRGPV VVHCSAGIGR TGCFIATSIG CQQLKEEGVV 240 DALSIVCQLR MDRGGMVQTS EQYEFVHHAL CLYES 275 // ID hPEST_D1\(NP_002826)\PTPN12 STANDARD;PRT; 288 AA. AC NP_002826; DT 3-JUL-2003 DE protein tyrosine phosphatase, non-receptor type 12; protein-tyrosine phosphatase G1 [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M93425.1. CC On Jan 25, 2002 this sequence version replaced gi:4506287. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains a C-terminal PEST CC motif, which serves as a protein-protein interaction domain, and CC may be related to protein intracellular half-life. This PTP was CC found to bind and dephosphorylate the product of oncogene c-ABL, CC thus may play a role in oncogenesis. This PTP was shown to interact CC with, and dephosphorylate, various of cytoskeleton and cell CC adhesion molecules, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and CC paxillin, which suggested its regulatory roles in controlling cell CC shape and mobility. CC GPRFLN|REFERENCE 1 (residues 1 to 780) CC GPRFLN| AUTHORS Lyons,P.D., Dunty,J.M., Schaefer,E.M. and Schaller,M.D. CC GPRFLN| TITLE Inhibition of the catalytic activity of cell adhesion kinase beta CC GPRFLN| by protein-tyrosine phosphatase-PEST-mediated dephosphorylation CC GPRFLN| JOURNAL J. Biol. Chem. 276 (26), 24422-24431 (2001) CC GPRFLN| MEDLINE 21316574 CC GPRFLN|REFERENCE 2 (residues 1 to 780) CC GPRFLN| AUTHORS Cong,F., Spencer,S., Cote,J.F., Wu,Y., Tremblay,M.L., Lasky,L.A. CC GPRFLN| and Goff,S.P. CC GPRFLN| TITLE Cytoskeletal protein PSTPIP1 directs the PEST-type protein tyrosine CC GPRFLN| phosphatase to the c-Abl kinase to mediate Abl dephosphorylation CC GPRFLN| JOURNAL Mol. Cell 6 (6), 1413-1423 (2000) CC GPRFLN| MEDLINE 21111050 CC GPRFLN|REFERENCE 3 (residues 1 to 780) CC GPRFLN| AUTHORS Shen,Y., Lyons,P., Cooley,M., Davidson,D., Veillette,A., Salgia,R., CC GPRFLN| Griffin,J.D. and Schaller,M.D. CC GPRFLN| TITLE The noncatalytic domain of protein-tyrosine phosphatase-PEST CC GPRFLN| targets paxillin for dephosphorylation in vivo CC GPRFLN| JOURNAL J. Biol. Chem. 275 (2), 1405-1413 (2000) CC GPRFLN| MEDLINE 20092920 CC GPRFLN|REFERENCE 4 (residues 1 to 780) CC GPRFLN| AUTHORS Nishiya,N., Iwabuchi,Y., Shibanuma,M., Cote,J.F., Tremblay,M.L. and CC GPRFLN| Nose,K. CC GPRFLN| TITLE Hic-5, a paxillin homologue, binds to the protein-tyrosine CC GPRFLN| phosphatase PEST (PTP-PEST) through its LIM 3 domain CC GPRFLN| JOURNAL J. Biol. Chem. 274 (14), 9847-9853 (1999) CC GPRFLN| MEDLINE 99194842 CC GPRFLN|REFERENCE 5 (residues 1 to 780) CC GPRFLN| AUTHORS Garton,A.J. and Tonks,N.K. CC GPRFLN| TITLE Regulation of fibroblast motility by the protein tyrosine CC GPRFLN| phosphatase PTP-PEST CC GPRFLN| JOURNAL J. Biol. Chem. 274 (6), 3811-3818 (1999) CC GPRFLN| MEDLINE 99121127 CC GPRFLN|REFERENCE 6 (residues 1 to 780) CC GPRFLN| AUTHORS Takekawa,M., Itoh,F., Hinoda,Y., Adachi,M., Ariyama,T., Inazawa,J., CC GPRFLN| Imai,K. and Yachi,A. CC GPRFLN| TITLE Chromosomal localization of the protein tyrosine phosphatase G1 CC GPRFLN| gene and characterization of the aberrant transcripts in human CC GPRFLN| colon cancer cells CC GPRFLN| JOURNAL FEBS Lett. 339 (3), 222-228 (1994) CC GPRFLN| MEDLINE 94156037 CC GPRFLN|REFERENCE 7 (residues 1 to 780) CC GPRFLN| AUTHORS Yang,Q., Co,D., Sommercorn,J. and Tonks,N.K. CC GPRFLN| TITLE Cloning and expression of PTP-PEST. A novel, human, CC GPRFLN| nontransmembrane protein tyrosine phosphatase CC GPRFLN| JOURNAL J. Biol. Chem. 268 (9), 6622-6628 (1993) CC GPRFLN| MEDLINE 93203262 CC GPRFLN|REFERENCE 8 (residues 1 to 780) CC GPRFLN| AUTHORS Takekawa,M., Itoh,F., Hinoda,Y., Arimura,Y., Toyota,M., Sekiya,M., CC GPRFLN| Adachi,M., Imai,K. and Yachi,A. CC GPRFLN| TITLE Cloning and characterization of a human cDNA encoding a novel CC GPRFLN| putative cytoplasmic protein-tyrosine-phosphatase CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 189 (2), 1223-1230 (1992) CC GPRFLN| MEDLINE 93112015 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 288 VNTIFKEY:269 FT PROTEIN 1 288 protein-tyrosine phosphatase G1 FT VNTIFKEY:270 FT REGION 21 288 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 288 AA; RKFIQRVQAM KSPDHNGEDN FARDFMRLRR LSTKYRTEKI YPTATGEKEE NVKKNRYKDI 60 LPFDHSRVKL TLKTPSQDSD YINANFIKGV YGPKAYVATQ GPLANTVIDF WRMIWEYNVV 120 IIVMACREFE MGRKKCERYW PLYGEDPITF APFKISCEDE QARTDYFIRT LLLEFQNESR 180 RLYQFHYVNW PDHDVPSSFD SILDMISLMR KYQEHEDVPI CIHCSAGCGR TGAICAIDYT 240 WNLLKAGKIP EEFNVFNLIQ EMRTQRHSAV QTKEQYELVH RAIAQLFE 288 // ID hPTP1B_D1\(NP_002818)\PTPN1 STANDARD;PRT; 279 AA. AC NP_002818; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 1; non-receptor tyrosine phophatase 1; protein tyrosine phophatase 1B; protein tyrosine phophatase, placental [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M33689.1 and AU117677.1. CC CC Summary: The protein encoded by this gene is the founding member of CC the protein tyrosine phosphatase (PTP) family, which was isolated CC and identified based on its enzymatic activity and amino acid CC sequence. PTPs catalyze the hydrolysis of the phosphate monoesters CC specifically on tyrosine residues. Members of the PTP family share CC a highly conserved catalytic motif, which is essential for the CC catalytic activity. PTPs are known to be signaling molecules that CC regulate a variety of cellular processes including cell growth, CC differentiation, mitotic cycle, and oncogenic transformation. This CC PTP has been shown to act as a negative regulator of insulin CC signaling by dephosphorylating the phosphotryosine residues of CC insulin receptor kinase. This PTP was also reported to CC dephosphorylate epidermal growth factor receptor kinase, as well as CC JAK2 and TYK2 kinases, which implicated the role of this PTP in CC cell growth control, and cell response to interferon stimulation. CC GPRFLN|REFERENCE 1 (residues 1 to 435) CC GPRFLN| AUTHORS Li,S. and Whorton,A.R. CC GPRFLN| TITLE Regulation of protein tyrosine phosphatase 1B in intact cells by CC GPRFLN| S-nitrosothiols CC GPRFLN| JOURNAL Arch. Biochem. Biophys. 410 (2), 269-279 (2003) CC GPRFLN| MEDLINE 22461115 CC GPRFLN| REMARK GeneRIF: PTP1B inhibition by S-nitrosylation is caused by formation CC GPRFLN| of a mixed disulfide CC GPRFLN|REFERENCE 2 (residues 1 to 435) CC GPRFLN| AUTHORS Fukada,T. and Tonks,N.K. CC GPRFLN| TITLE Identification of YB-1 as a regulator of PTP1B expression: CC GPRFLN| implications for regulation of insulin and cytokine signaling CC GPRFLN| JOURNAL EMBO J. 22 (3), 479-493 (2003) CC GPRFLN| MEDLINE 22441887 CC GPRFLN| REMARK GeneRIF: Data show that Y box-binding protein-1 (YB-1) is a CC GPRFLN| regulator of protein tyrosine phosphatase 1B (PTP1B) expression, CC GPRFLN| and highlight PTP1B as a critical regulator of insulin- and CC GPRFLN| cytokine-mediated signal transduction. CC GPRFLN|REFERENCE 3 (residues 1 to 435) CC GPRFLN| AUTHORS Yigzaw,Y., Poppleton,H.M., Sreejayan,N., Hassid,A. and Patel,T.B. CC GPRFLN| TITLE Protein-tyrosine phosphatase-1B (PTP1B) mediates the anti-migratory CC GPRFLN| actions of Sprouty CC GPRFLN| JOURNAL J. Biol. Chem. 278 (1), 284-288 (2003) CC GPRFLN| MEDLINE 22393490 CC GPRFLN| REMARK GeneRIF: Data show that an increase in soluble protein-tyrosine CC GPRFLN| phosphatase 1B activity contributes to the anti-migratory, but not CC GPRFLN| anti-mitogenic, actions of human Sprouty 2. CC GPRFLN|REFERENCE 4 (residues 1 to 435) CC GPRFLN| AUTHORS Di Paola,R., Frittitta,L., Miscio,G., Bozzali,M., Baratta,R., CC GPRFLN| Centra,M., Spampinato,D., Santagati,M.G., Ercolino,T., CC GPRFLN| Cisternino,C., Soccio,T., Mastroianno,S., Tassi,V., Almgren,P., CC GPRFLN| Pizzuti,A., Vigneri,R. and Trischitta,V. CC GPRFLN| TITLE A variation in 3' UTR of hPTP1B increases specific gene expression CC GPRFLN| and associates with insulin resistance CC GPRFLN| JOURNAL Am. J. Hum. Genet. 70 (3), 806-812 (2002) CC GPRFLN| MEDLINE 21832513 CC GPRFLN| REMARK GeneRIF: variation in 3' UTR of hPTP1B increases specific gene CC GPRFLN| expression and associates with insulin resistance CC GPRFLN|REFERENCE 5 (residues 1 to 435) CC GPRFLN| AUTHORS Myers,M.P., Andersen,J.N., Cheng,A., Tremblay,M.L., Horvath,C.M., CC GPRFLN| Parisien,J.P., Salmeen,A., Barford,D. and Tonks,N.K. CC GPRFLN| TITLE TYK2 and JAK2 are substrates of protein-tyrosine phosphatase 1B CC GPRFLN| JOURNAL J. Biol. Chem. 276 (51), 47771-47774 (2001) CC GPRFLN| MEDLINE 21611285 CC GPRFLN|REFERENCE 6 (residues 1 to 435) CC GPRFLN| AUTHORS Wang,J., Cheung,A.T., Kolls,J.K., Starks,W.W., CC GPRFLN| Martinez-Hernandez,A., Dietzen,D. and Bryer-Ash,M. CC GPRFLN| TITLE Effects of adenovirus-mediated liver-selective overexpression of CC GPRFLN| protein tyrosine phosphatase-1b on insulin sensitivity in vivo CC GPRFLN| JOURNAL Diabetes Obes Metab 3 (5), 367-380 (2001) CC GPRFLN| MEDLINE 21560532 CC GPRFLN| REMARK GeneRIF: Moderate overabundance of PTP-1B in liver tissue does not CC GPRFLN| alter insulin action on glucose metabolism, and the site of action CC GPRFLN| of PTP-1B is presumably at insulin-responsive target tissue or CC GPRFLN| tissues other than the liver. CC GPRFLN|REFERENCE 7 (residues 1 to 435) CC GPRFLN| AUTHORS Dadke,S., Kusari,A. and Kusari,J. CC GPRFLN| TITLE Phosphorylation and activation of protein tyrosine phosphatase CC GPRFLN| (PTP) 1B by insulin receptor CC GPRFLN| JOURNAL Mol. Cell. Biochem. 221 (1-2), 147-154 (2001) CC GPRFLN| MEDLINE 21396990 CC GPRFLN|REFERENCE 8 (residues 1 to 435) CC GPRFLN| AUTHORS Egawa,K., Maegawa,H., Shimizu,S., Morino,K., Nishio,Y., CC GPRFLN| Bryer-Ash,M., Cheung,A.T., Kolls,J.K., Kikkawa,R. and Kashiwagi,A. CC GPRFLN| TITLE Protein-tyrosine phosphatase-1B negatively regulates insulin CC GPRFLN| signaling in l6 myocytes and Fao hepatoma cells CC GPRFLN| JOURNAL J. Biol. Chem. 276 (13), 10207-10211 (2001) CC GPRFLN| MEDLINE 21167830 CC GPRFLN|REFERENCE 9 (residues 1 to 435) CC GPRFLN| AUTHORS Salmeen,A., Andersen,J.N., Myers,M.P., Tonks,N.K. and Barford,D. CC GPRFLN| TITLE Molecular basis for the dephosphorylation of the activation segment CC GPRFLN| of the insulin receptor by protein tyrosine phosphatase 1B CC GPRFLN| JOURNAL Mol. Cell 6 (6), 1401-1412 (2000) CC GPRFLN| MEDLINE 21111049 CC GPRFLN|REFERENCE 10 (residues 1 to 435) CC GPRFLN| AUTHORS Peters,G.H., Iversen,L.F., Branner,S., Andersen,H.S., CC GPRFLN| Mortensen,S.B., Olsen,O.H., Moller,K.B. and Moller,N.P. CC GPRFLN| TITLE Residue 259 is a key determinant of substrate specificity of CC GPRFLN| protein-tyrosine phosphatases 1B and alpha CC GPRFLN| JOURNAL J. Biol. Chem. 275 (24), 18201-18209 (2000) CC GPRFLN| MEDLINE 20309769 CC GPRFLN|REFERENCE 11 (residues 1 to 435) CC GPRFLN| AUTHORS Ahmad,F., Li,P.M., Meyerovitch,J. and Goldstein,B.J. CC GPRFLN| TITLE Osmotic loading of neutralizing antibodies demonstrates a role for CC GPRFLN| protein-tyrosine phosphatase 1B in negative regulation of the CC GPRFLN| insulin action pathway CC GPRFLN| JOURNAL J. Biol. Chem. 270 (35), 20503-20508 (1995) CC GPRFLN| MEDLINE 95386495 CC GPRFLN|REFERENCE 12 (residues 1 to 435) CC GPRFLN| AUTHORS Milarski,K.L., Zhu,G., Pearl,C.G., McNamara,D.J., Dobrusin,E.M., CC GPRFLN| MacLean,D., Thieme-Sefler,A., Zhang,Z.Y., Sawyer,T., Decker,S.J. et CC GPRFLN| al. CC GPRFLN| TITLE Sequence specificity in recognition of the epidermal growth factor CC GPRFLN| receptor by protein tyrosine phosphatase 1B CC GPRFLN| JOURNAL J. Biol. Chem. 268 (31), 23634-23639 (1993) CC GPRFLN| MEDLINE 94043167 CC GPRFLN|REFERENCE 13 (residues 1 to 435) CC GPRFLN| AUTHORS Brown-Shimer,S., Johnson,K.A., Lawrence,J.B., Johnson,C., CC GPRFLN| Bruskin,A., Green,N.R. and Hill,D.E. CC GPRFLN| TITLE Molecular cloning and chromosome mapping of the human gene encoding CC GPRFLN| protein phosphotyrosyl phosphatase 1B CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (13), 5148-5152 (1990) CC GPRFLN| MEDLINE 90311360 CC GPRFLN|REFERENCE 14 (residues 1 to 435) CC GPRFLN| AUTHORS Chernoff,J., Schievella,A.R., Jost,C.A., Erikson,R.L. and Neel,B.G. CC GPRFLN| TITLE Cloning of a cDNA for a major human protein-tyrosine-phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (7), 2735-2739 (1990) CC GPRFLN| MEDLINE 90207272 CC GPRFLN|REFERENCE 15 (residues 1 to 435) CC GPRFLN| AUTHORS Charbonneau,H., Tonks,N.K., Kumar,S., Diltz,C.D., Harrylock,M., CC GPRFLN| Cool,D.E., Krebs,E.G., Fischer,E.H. and Walsh,K.A. CC GPRFLN| TITLE Human placenta protein-tyrosine-phosphatase: amino acid sequence CC GPRFLN| and relationship to a family of receptor-like proteins CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 86 (14), 5252-5256 (1989) CC GPRFLN| MEDLINE 89315775 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 non-receptor tyrosine phophatase 1; protein tyrosine phophatase 1B; protein tyrosine phophatase, placental FT VNTIFKEY:270 FT REGION 3 279 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; MEMEKEFEQI DKSGSWAAIY QDIRHEASDF PCRVAKLPKN KNRNRYRDVS PFDHSRIKLH 60 QEDNDYINAS LIKMEEAQRS YILTQGPLPN TCGHFWEMVW EQKSRGVVML NRVMEKGSLK 120 CAQYWPQKEE KEMIFEDTNL KLTLISEDIK SYYTVRQLEL ENLTTQETRE ILHFHYTTWP 180 DFGVPESPAS FLNFLFKVRE SGSLSPEHGP VVVHCSAGIG RSGTFCLADT CLLLMDKRKD 240 PSSVDIKKVL LEMRKFRMGL IQTADQLRFS YLAVIEGAK 279 // ID hPTPalpha_D1\(NP_002827)\PTPRA STANDARD;PRT; 280 AA. AC NP_002827; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, A isoform 1 precursor; protein tyrosine phosphatase, receptor type, alpha polypeptide; PTPase-alpha; Leukocyte common antigen-related peptide (protein tyrosine phosphate); tyrosine phosphatase alpha; PTPLCA-related phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M34668.1 and AI284972.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC domain, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. This PTP has been shown to dephosphorylate and CC activate Src family tyrosine kinases, and is implicated in the CC regulation of integrin signaling, cell adhesion and proliferation. CC Three alternatively spliced variants of this gene, which encode two CC distinct isoforms, have been reported. CC CC Transcript Variant: This variant (1) contains a unique 5' UTR CC region when compared to other variants. The genomic exons forming CC the 5' end region of this transcript are also used to form an CC internal coding region in the transcripts of VPS16, a distinct gene CC located at the locus immediately upstream of this gene on CC chromosome 20. This variant encodes the longest isoform (1). CC GPRFLN|REFERENCE 1 (residues 1 to 802) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 802) CC GPRFLN| AUTHORS Mustelin,T. and Hunter,T. CC GPRFLN| TITLE Meeting at mitosis: cell cycle-specific regulation of c-Src by CC GPRFLN| RPTPalpha CC GPRFLN| JOURNAL Sci STKE 2002 (115), PE3 (2002) CC GPRFLN| MEDLINE 21655780 CC GPRFLN| REMARK GeneRIF: In entering mitosis the cell cycle-specific regulation of CC GPRFLN| c-Src by RPTPalpha can occur by dephosphorylation of phospho-Tyr527 CC GPRFLN| that activates c-Src in a reaction catalyzed by the transmembrane CC GPRFLN| receptor-like protein tyrosine phosphatase RPTPalpha. CC GPRFLN|REFERENCE 3 (residues 1 to 802) CC GPRFLN| AUTHORS Ardini,E., Agresti,R., Tagliabue,E., Greco,M., Aiello,P., CC GPRFLN| Yang,L.T., Menard,S. and Sap,J. CC GPRFLN| TITLE Expression of protein tyrosine phosphatase alpha (RPTPalpha) in CC GPRFLN| human breast cancer correlates with low tumor grade, and inhibits CC GPRFLN| tumor cell growth in vitro and in vivo CC GPRFLN| JOURNAL Oncogene 19 (43), 4979-4987 (2000) CC GPRFLN| MEDLINE 20499263 CC GPRFLN|REFERENCE 4 (residues 1 to 802) CC GPRFLN| AUTHORS Peters,G.H., Iversen,L.F., Branner,S., Andersen,H.S., CC GPRFLN| Mortensen,S.B., Olsen,O.H., Moller,K.B. and Moller,N.P. CC GPRFLN| TITLE Residue 259 is a key determinant of substrate specificity of CC GPRFLN| protein-tyrosine phosphatases 1B and alpha CC GPRFLN| JOURNAL J. Biol. Chem. 275 (24), 18201-18209 (2000) CC GPRFLN| MEDLINE 20309769 CC GPRFLN|REFERENCE 5 (residues 1 to 802) CC GPRFLN| AUTHORS Harder,K.W., Moller,N.P., Peacock,J.W. and Jirik,F.R. CC GPRFLN| TITLE Protein-tyrosine phosphatase alpha regulates Src family kinases and CC GPRFLN| alters cell-substratum adhesion CC GPRFLN| JOURNAL J. Biol. Chem. 273 (48), 31890-31900 (1998) CC GPRFLN| MEDLINE 99041953 CC GPRFLN|REFERENCE 6 (residues 1 to 802) CC GPRFLN| AUTHORS Zheng,X.M., Wang,Y. and Pallen,C.J. CC GPRFLN| TITLE Cell transformation and activation of pp60c-src by overexpression CC GPRFLN| of a protein tyrosine phosphatase CC GPRFLN| JOURNAL Nature 359 (6393), 336-339 (1992) CC GPRFLN| MEDLINE 93024881 CC GPRFLN|REFERENCE 7 (residues 1 to 802) CC GPRFLN| AUTHORS Rao,V.V., Loffler,C., Sap,J., Schlessinger,J. and Hansmann,I. CC GPRFLN| TITLE The gene for receptor-linked protein-tyrosine-phosphatase (PTPA) is CC GPRFLN| assigned to human chromosome 20p12-pter by in situ hybridization CC GPRFLN| (ISH and FISH) CC GPRFLN| JOURNAL Genomics 13 (3), 906-907 (1992) CC GPRFLN| MEDLINE 92347910 CC GPRFLN|REFERENCE 8 (residues 1 to 802) CC GPRFLN| AUTHORS Ohagi,S., Nishi,M. and Steiner,D.F. CC GPRFLN| TITLE Sequence of a cDNA encoding human LRP (leukocyte common CC GPRFLN| antigen-related peptide) CC GPRFLN| JOURNAL Nucleic Acids Res. 18 (23), 7159 (1990) CC GPRFLN| MEDLINE 91088320 CC GPRFLN|REFERENCE 9 (residues 1 to 802) CC GPRFLN| AUTHORS Jirik,F.R., Janzen,N.M., Melhado,I.G. and Harder,K.W. CC GPRFLN| TITLE Cloning and chromosomal assignment of a widely expressed human CC GPRFLN| receptor-like protein-tyrosine phosphatase CC GPRFLN| JOURNAL FEBS Lett. 273 (1-2), 239-242 (1990) CC GPRFLN| MEDLINE 91032191 CC GPRFLN|REFERENCE 10 (residues 1 to 802) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC GPRFLN|REFERENCE 11 (residues 1 to 802) CC GPRFLN| AUTHORS Kaplan,R., Morse,B., Huebner,K., Croce,C., Howk,R., Ravera,M., CC GPRFLN| Ricca,G., Jaye,M. and Schlessinger,J. CC GPRFLN| TITLE Cloning of three human tyrosine phosphatases reveals a multigene CC GPRFLN| family of receptor-linked protein-tyrosine-phosphatases expressed CC GPRFLN| in brain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7000-7004 (1990) CC GPRFLN| MEDLINE 90384936 CC GPRFLN|REFERENCE 12 (residues 1 to 802) CC GPRFLN| AUTHORS Sap,J., D'Eustachio,P., Givol,D. and Schlessinger,J. CC GPRFLN| TITLE Cloning and expression of a widely expressed receptor tyrosine CC GPRFLN| phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (16), 6112-6116 (1990) CC GPRFLN| MEDLINE 90349565 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 280 VNTIFKEY:269 FT PROTEIN 1 280 protein tyrosine phosphatase, receptor type, alpha polypeptide; PTPase-alpha; Leukocyte common antigen-related peptide (protein tyrosine phosphate); tyrosine phosphatase alpha; PTPLCA-related phosphatase FT VNTIFKEY:270 FT CHAIN 1 280 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 280 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 280 AA; DKLEEEINRR MADDNKLFRE EFNALPACPI QATCEAASKE ENKEKNRYVN ILPYDHSRVH 60 LTPVEGVPDS DYINASFING YQEKNKFIAA QGPKEETVND FWRMIWEQNT ATIVMVTNLK 120 ERKECKCAQY WPDQGCWTYG NIRVSVEDVT VLVDYTVRKF CIQQVGDMTN RKPQRLITQF 180 HFTSWPDFGV PFTPIGMLKF LKKVKACNPQ YAGAIVVHCS AGVGRTGTFV VIDAMLDMMH 240 TERKVDVYGF VSRIRAQRCQ MVQTDMQYVF IYQALLEHYL 280 // ID hPTPalpha_D2\(NP_002827)\PTPRA STANDARD;PRT; 282 AA. AC NP_002827; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, A isoform 1 precursor; protein tyrosine phosphatase, receptor type, alpha polypeptide; PTPase-alpha; Leukocyte common antigen-related peptide (protein tyrosine phosphate); tyrosine phosphatase alpha; PTPLCA-related phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M34668.1 and AI284972.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC domain, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. This PTP has been shown to dephosphorylate and CC activate Src family tyrosine kinases, and is implicated in the CC regulation of integrin signaling, cell adhesion and proliferation. CC Three alternatively spliced variants of this gene, which encode two CC distinct isoforms, have been reported. CC CC Transcript Variant: This variant (1) contains a unique 5' UTR CC region when compared to other variants. The genomic exons forming CC the 5' end region of this transcript are also used to form an CC internal coding region in the transcripts of VPS16, a distinct gene CC located at the locus immediately upstream of this gene on CC chromosome 20. This variant encodes the longest isoform (1). CC GPRFLN|REFERENCE 1 (residues 1 to 802) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 802) CC GPRFLN| AUTHORS Mustelin,T. and Hunter,T. CC GPRFLN| TITLE Meeting at mitosis: cell cycle-specific regulation of c-Src by CC GPRFLN| RPTPalpha CC GPRFLN| JOURNAL Sci STKE 2002 (115), PE3 (2002) CC GPRFLN| MEDLINE 21655780 CC GPRFLN| REMARK GeneRIF: In entering mitosis the cell cycle-specific regulation of CC GPRFLN| c-Src by RPTPalpha can occur by dephosphorylation of phospho-Tyr527 CC GPRFLN| that activates c-Src in a reaction catalyzed by the transmembrane CC GPRFLN| receptor-like protein tyrosine phosphatase RPTPalpha. CC GPRFLN|REFERENCE 3 (residues 1 to 802) CC GPRFLN| AUTHORS Ardini,E., Agresti,R., Tagliabue,E., Greco,M., Aiello,P., CC GPRFLN| Yang,L.T., Menard,S. and Sap,J. CC GPRFLN| TITLE Expression of protein tyrosine phosphatase alpha (RPTPalpha) in CC GPRFLN| human breast cancer correlates with low tumor grade, and inhibits CC GPRFLN| tumor cell growth in vitro and in vivo CC GPRFLN| JOURNAL Oncogene 19 (43), 4979-4987 (2000) CC GPRFLN| MEDLINE 20499263 CC GPRFLN|REFERENCE 4 (residues 1 to 802) CC GPRFLN| AUTHORS Peters,G.H., Iversen,L.F., Branner,S., Andersen,H.S., CC GPRFLN| Mortensen,S.B., Olsen,O.H., Moller,K.B. and Moller,N.P. CC GPRFLN| TITLE Residue 259 is a key determinant of substrate specificity of CC GPRFLN| protein-tyrosine phosphatases 1B and alpha CC GPRFLN| JOURNAL J. Biol. Chem. 275 (24), 18201-18209 (2000) CC GPRFLN| MEDLINE 20309769 CC GPRFLN|REFERENCE 5 (residues 1 to 802) CC GPRFLN| AUTHORS Harder,K.W., Moller,N.P., Peacock,J.W. and Jirik,F.R. CC GPRFLN| TITLE Protein-tyrosine phosphatase alpha regulates Src family kinases and CC GPRFLN| alters cell-substratum adhesion CC GPRFLN| JOURNAL J. Biol. Chem. 273 (48), 31890-31900 (1998) CC GPRFLN| MEDLINE 99041953 CC GPRFLN|REFERENCE 6 (residues 1 to 802) CC GPRFLN| AUTHORS Zheng,X.M., Wang,Y. and Pallen,C.J. CC GPRFLN| TITLE Cell transformation and activation of pp60c-src by overexpression CC GPRFLN| of a protein tyrosine phosphatase CC GPRFLN| JOURNAL Nature 359 (6393), 336-339 (1992) CC GPRFLN| MEDLINE 93024881 CC GPRFLN|REFERENCE 7 (residues 1 to 802) CC GPRFLN| AUTHORS Rao,V.V., Loffler,C., Sap,J., Schlessinger,J. and Hansmann,I. CC GPRFLN| TITLE The gene for receptor-linked protein-tyrosine-phosphatase (PTPA) is CC GPRFLN| assigned to human chromosome 20p12-pter by in situ hybridization CC GPRFLN| (ISH and FISH) CC GPRFLN| JOURNAL Genomics 13 (3), 906-907 (1992) CC GPRFLN| MEDLINE 92347910 CC GPRFLN|REFERENCE 8 (residues 1 to 802) CC GPRFLN| AUTHORS Ohagi,S., Nishi,M. and Steiner,D.F. CC GPRFLN| TITLE Sequence of a cDNA encoding human LRP (leukocyte common CC GPRFLN| antigen-related peptide) CC GPRFLN| JOURNAL Nucleic Acids Res. 18 (23), 7159 (1990) CC GPRFLN| MEDLINE 91088320 CC GPRFLN|REFERENCE 9 (residues 1 to 802) CC GPRFLN| AUTHORS Jirik,F.R., Janzen,N.M., Melhado,I.G. and Harder,K.W. CC GPRFLN| TITLE Cloning and chromosomal assignment of a widely expressed human CC GPRFLN| receptor-like protein-tyrosine phosphatase CC GPRFLN| JOURNAL FEBS Lett. 273 (1-2), 239-242 (1990) CC GPRFLN| MEDLINE 91032191 CC GPRFLN|REFERENCE 10 (residues 1 to 802) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC GPRFLN|REFERENCE 11 (residues 1 to 802) CC GPRFLN| AUTHORS Kaplan,R., Morse,B., Huebner,K., Croce,C., Howk,R., Ravera,M., CC GPRFLN| Ricca,G., Jaye,M. and Schlessinger,J. CC GPRFLN| TITLE Cloning of three human tyrosine phosphatases reveals a multigene CC GPRFLN| family of receptor-linked protein-tyrosine-phosphatases expressed CC GPRFLN| in brain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7000-7004 (1990) CC GPRFLN| MEDLINE 90384936 CC GPRFLN|REFERENCE 12 (residues 1 to 802) CC GPRFLN| AUTHORS Sap,J., D'Eustachio,P., Givol,D. and Schlessinger,J. CC GPRFLN| TITLE Cloning and expression of a widely expressed receptor tyrosine CC GPRFLN| phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (16), 6112-6116 (1990) CC GPRFLN| MEDLINE 90349565 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 282 VNTIFKEY:269 FT PROTEIN 1 282 protein tyrosine phosphatase, receptor type, alpha polypeptide; PTPase-alpha; Leukocyte common antigen-related peptide (protein tyrosine phosphate); tyrosine phosphatase alpha; PTPLCA-related phosphatase FT VNTIFKEY:270 FT CHAIN 1 282 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 21 281 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 282 AA; TSLETHLQKI YNKIPGTSNN GLEEEFKKLT SIKIQNDKMR TGNLPANMKK NRVLQIIPYE 60 FNRVIIPVKR GEENTDYVNA SFIDGYRQKD SYIASQGPLL HTIEDFWRMI WEWKSCSIVM 120 LTELEERGQE KCAQYWPSDG LVSYGDITVE LKKEEECESY TVRDLLVTNT RENKSRQIRQ 180 FHFHGWPEVG IPSDGKGMIS IIAAVQKQQQ QSGNHPITVH CSAGAGRTGT FCALSTVLER 240 VKAEGILDVF QTVKSLRLQR PHMVQTLEQY EFCYKVVQEY ID 282 // ID hPTPBAS_D1\(NP_006255)\PTPN13 STANDARD;PRT; 275 AA. AC NP_006255; DT 30-JUN-2003 DE protein tyrosine phosphatase, non-receptor type 13 isoform 2; protein tyrosine phosphatase, nonreceptor type 13; protein tyrosine phosphatase 1E; Fas-associated phosphatase-1; protein-tyrosine phosphatase 1, Fas-associated; protein-tyrosine phophatase PTPL1; APO-1/CD95 (Fas)-associated phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from D21210.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP is a large protein that CC possesses a PTP domain at C-terminus, and multiple noncatalytic CC domains, which include a domain with similarity to band 4.1 CC superfamily of cytoskeletal-associated proteins, a region CC consisting of five PDZ domains, and a leucine zipper motif. This CC PTP was found to interact with, and dephosphorylate Fas receptor, CC as well as IkappaBalpha through the PDZ domains, which suggested CC its role in Fas mediated programmed cell death. This PTP was also CC shown to interact with GTPase-activating protein, and thus may CC function as a regulator of Rho signaling pathway. Four CC alternatively spliced transcript variants, which encode distinct CC proteins, have been reported. CC CC Transcript Variant: This variant (2) lacks an internal fragment CC within the coding region when compared to variant 4. The CC translation remains in frame, and the encoded protein lacks CC internal 19 aa, as compared to isoform 4. CC GPRFLN|REFERENCE 1 (residues 1 to 2466) CC GPRFLN| AUTHORS Yoshida,S., Harada,H., Nagai,H., Fukino,K., Teramoto,A. and Emi,M. CC GPRFLN| TITLE Head-to-head juxtaposition of Fas-associated phosphatase-1 (FAP-1) CC GPRFLN| and c-Jun NH2-terminal kinase 3 (JNK3) genes: genomic structure and CC GPRFLN| seven polymorphisms of the FAP-1 gene CC GPRFLN| JOURNAL J. Hum. Genet. 47 (11), 614-619 (2002) CC GPRFLN| MEDLINE 22323362 CC GPRFLN| REMARK GeneRIF: Shares a promoter region with the tightly linked gene CC GPRFLN| encoding stress-activated protein kinase JNK3. CC GPRFLN|REFERENCE 2 (residues 1 to 2466) CC GPRFLN| AUTHORS Bompard,G., Puech,C., Prebois,C., Vignon,F. and Freiss,G. CC GPRFLN| TITLE Protein-tyrosine phosphatase PTPL1/FAP-1 triggers apoptosis in CC GPRFLN| human breast cancer cells CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47861-47869 (2002) CC GPRFLN| MEDLINE 22344658 CC GPRFLN| REMARK GeneRIF: PTPL1/FAP-1 has a key role in the apoptotic process in CC GPRFLN| human breast cancer cells independent of Fas but associated with an CC GPRFLN| early inhibition of the insulin receptor CC GPRFLN| substrate-1/phosphatidylinositol 3-kinase pathway CC GPRFLN|REFERENCE 3 (residues 1 to 2466) CC GPRFLN| AUTHORS Kozlov,G., Banville,D., Gehring,K. and Ekiel,I. CC GPRFLN| TITLE Solution structure of the PDZ2 domain from cytosolic human CC GPRFLN| phosphatase hPTP1E complexed with a peptide reveals contribution of CC GPRFLN| the beta2-beta3 loop to PDZ domain-ligand interactions CC GPRFLN| JOURNAL J. Mol. Biol. 320 (4), 813-820 (2002) CC GPRFLN| MEDLINE 22090786 CC GPRFLN| REMARK GeneRIF: PDZ2 domain from cytosolic human phosphatase hPTP1E CC GPRFLN| complexed with peptide, RA-GEF-2, reveals contribution of the CC GPRFLN| beta2-beta3 loop to PDZ domain-ligand interactions CC GPRFLN|REFERENCE 4 (residues 1 to 2466) CC GPRFLN| AUTHORS Walma,T., Spronk,C.A., Tessari,M., Aelen,J., Schepens,J., CC GPRFLN| Hendriks,W. and Vuister,G.W. CC GPRFLN| TITLE Structure, dynamics and binding characteristics of the second PDZ CC GPRFLN| domain of PTP-BL CC GPRFLN| JOURNAL J. Mol. Biol. 316 (5), 1101-1110 (2002) CC GPRFLN| MEDLINE 21881810 CC GPRFLN| REMARK GeneRIF: Structure, dynamics and binding characteristics of the CC GPRFLN| second PDZ domain of PTP-BL CC GPRFLN|REFERENCE 5 (residues 1 to 2466) CC GPRFLN| AUTHORS Marin,L., Minguela,A., Moya-Quiles,M.R., Torio,A., Muro,M., CC GPRFLN| Garcia-Alonso,A.M., Sanchez-Bueno,F., Bru,M., Parrilla,P. and CC GPRFLN| Alvarez-Lopez,M.R. CC GPRFLN| TITLE Expression of CD95 and apoptosis induction in peripheral blood CC GPRFLN| cells from liver graft recipients CC GPRFLN| JOURNAL Transplant. Proc. 34 (1), 280-282 (2002) CC GPRFLN| MEDLINE 21957524 CC GPRFLN| REMARK GeneRIF: expression and apoptosis induction in peripheral blood CC GPRFLN| cells from liver graft CC GPRFLN|REFERENCE 6 (residues 1 to 2466) CC GPRFLN| AUTHORS Nakai,Y., Irie,S. and Sato,T.A. CC GPRFLN| TITLE Identification of IkappaBalpha as a substrate of Fas-associated CC GPRFLN| phosphatase-1 CC GPRFLN| JOURNAL Eur. J. Biochem. 267 (24), 7170-7175 (2000) CC GPRFLN| MEDLINE 20558254 CC GPRFLN|REFERENCE 7 (residues 1 to 2466) CC GPRFLN| AUTHORS Irie,S., Hachiya,T., Rabizadeh,S., Maruyama,W., Mukai,J., Li,Y., CC GPRFLN| Reed,J.C., Bredesen,D.E. and Sato,T.A. CC GPRFLN| TITLE Functional interaction of Fas-associated phosphatase-1 (FAP-1) with CC GPRFLN| p75(NTR) and their effect on NF-kappaB activation CC GPRFLN| JOURNAL FEBS Lett. 460 (2), 191-198 (1999) CC GPRFLN| MEDLINE 20012928 CC GPRFLN|REFERENCE 8 (residues 1 to 2466) CC GPRFLN| AUTHORS Maekawa,K., Imagawa,N., Naito,A., Harada,S., Yoshie,O. and CC GPRFLN| Takagi,S. CC GPRFLN| TITLE Association of protein-tyrosine phosphatase PTP-BAS with the CC GPRFLN| transcription-factor-inhibitory protein IkappaBalpha through CC GPRFLN| interaction between the PDZ1 domain and ankyrin repeats CC GPRFLN| JOURNAL Biochem. J. 337 (Pt 2), 179-184 (1999) CC GPRFLN| MEDLINE 99102074 CC GPRFLN|REFERENCE 9 (residues 1 to 2466) CC GPRFLN| AUTHORS Saras,J., Franzen,P., Aspenstrom,P., Hellman,U., Gonez,L.J. and CC GPRFLN| Heldin,C.H. CC GPRFLN| TITLE A novel GTPase-activating protein for Rho interacts with a PDZ CC GPRFLN| domain of the protein-tyrosine phosphatase PTPL1 CC GPRFLN| JOURNAL J. Biol. Chem. 272 (39), 24333-24338 (1997) CC GPRFLN| MEDLINE 97450957 CC GPRFLN|REFERENCE 10 (residues 1 to 2466) CC GPRFLN| AUTHORS Saras,J., Engstrom,U., Gonez,L.J. and Heldin,C.H. CC GPRFLN| TITLE Characterization of the interactions between PDZ domains of the CC GPRFLN| protein-tyrosine phosphatase PTPL1 and the carboxyl-terminal tail CC GPRFLN| of Fas CC GPRFLN| JOURNAL J. Biol. Chem. 272 (34), 20979-20981 (1997) CC GPRFLN| MEDLINE 97407871 CC GPRFLN|REFERENCE 11 (residues 1 to 2466) CC GPRFLN| AUTHORS Yanagisawa,J., Takahashi,M., Kanki,H., Yano-Yanagisawa,H., CC GPRFLN| Tazunoki,T., Sawa,E., Nishitoba,T., Kamishohara,M., Kobayashi,E., CC GPRFLN| Kataoka,S. and Sato,T. CC GPRFLN| TITLE The molecular interaction of Fas and FAP-1. A tripeptide blocker of CC GPRFLN| human Fas interaction with FAP-1 promotes Fas-induced apoptosis CC GPRFLN| JOURNAL J. Biol. Chem. 272 (13), 8539-8545 (1997) CC GPRFLN| MEDLINE 97236811 CC GPRFLN|REFERENCE 12 (residues 1 to 2466) CC GPRFLN| AUTHORS Inazawa,J., Ariyama,T., Abe,T., Druck,T., Ohta,M., Huebner,K., CC GPRFLN| Yanagisawa,J., Reed,J.C. and Sato,T. CC GPRFLN| TITLE PTPN13, a fas-associated protein tyrosine phosphatase, is located CC GPRFLN| on the long arm of chromosome 4 at band q21.3 CC GPRFLN| JOURNAL Genomics 31 (2), 240-242 (1996) CC GPRFLN| MEDLINE 96422192 CC GPRFLN|REFERENCE 13 (residues 1 to 2466) CC GPRFLN| AUTHORS Sato,T., Irie,S., Kitada,S. and Reed,J.C. CC GPRFLN| TITLE FAP-1: a protein tyrosine phosphatase that associates with Fas CC GPRFLN| JOURNAL Science 268 (5209), 411-415 (1995) CC GPRFLN| MEDLINE 95232528 CC GPRFLN|REFERENCE 14 (residues 1 to 2466) CC GPRFLN| AUTHORS Saras,J., Claesson-Welsh,L., Heldin,C.H. and Gonez,L.J. CC GPRFLN| TITLE Cloning and characterization of PTPL1, a protein tyrosine CC GPRFLN| phosphatase with similarities to cytoskeletal-associated proteins CC GPRFLN| JOURNAL J. Biol. Chem. 269 (39), 24082-24089 (1994) CC GPRFLN| MEDLINE 95014139 CC GPRFLN|REFERENCE 15 (residues 1 to 2466) CC GPRFLN| AUTHORS Banville,D., Ahmad,S., Stocco,R. and Shen,S.H. CC GPRFLN| TITLE A novel protein-tyrosine phosphatase with homology to both the CC GPRFLN| cytoskeletal proteins of the band 4.1 family and CC GPRFLN| junction-associated guanylate kinases CC GPRFLN| JOURNAL J. Biol. Chem. 269 (35), 22320-22327 (1994) CC GPRFLN| MEDLINE 94350988 CC GPRFLN|REFERENCE 16 (residues 1 to 2466) CC GPRFLN| AUTHORS Maekawa,K., Imagawa,N., Nagamatsu,M. and Harada,S. CC GPRFLN| TITLE Molecular cloning of a novel protein-tyrosine phosphatase CC GPRFLN| containing a membrane-binding domain and GLGF repeats CC GPRFLN| JOURNAL FEBS Lett. 337 (2), 200-206 (1994) CC GPRFLN| MEDLINE 94116679 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 4 275 VNTIFKEY:269 FT PROTEIN 4 275 protein tyrosine phosphatase, nonreceptor type 13; protein tyrosine phosphatase 1E; Fas-associated phosphatase-1; protein-tyrosine phosphatase 1, Fas-associated; protein-tyrosine phophatase PTPL1; APO-1/CD95 (Fas)-associated phosphatase FT VNTIFKEY:270 FT REGION 20 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 275 AA; ANLKSVIRVL RGLLDQGIPS KELENLQELK PLDQCLIGQT KENRRKNRYK NILPYDATRV 60 PLGDEGGYIN ASFIKIPVGK EEFVYIACQG PLPTTVGDFW QMIWEQKSTV IAMMTQEVEG 120 EKIKCQRYWP NILGKTTMVS NRLRLALVRM QQLKGFVVRA MTLEDIQTRE VRHISHLNFT 180 AWPDHDTPSQ PDDLLTFISY MRHIHRSGPI ITHCSAGIGR SGTLICIDVV LGLISQDLDF 240 DISDLVRCMR LQRHGMVQTE DQYIFCYQVI LYVLT 275 // ID hPTPbeta_D1\(NP_002828)\PTPRB STANDARD;PRT; 280 AA. AC NP_002828; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, B precursor; protein tyrosine phosphatase, receptor type, beta polypeptide; protein tyrosine phosphatase beta [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X54131.1 and BE042873.1. CC On Feb 4, 2002 this sequence version replaced gi:4506305. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC domain, a single transmembrane segment and one intracytoplasmic CC catalytic domain, thus belongs to receptor type PTP. The CC extracellular region of this PTP is composed of multiple CC fibronectin type_III repeats, which was shown to interact with CC neuronal receptor and cell adhesion molecules, such as contactin CC and tenascin C. This protein was also found to interact with sodium CC channels, and thus may regulate sodium channels by altering CC tyrosine phosphorylation status. The functions of the interaction CC partners of this protein implicate the roles of this PTP in cell CC adhesion, neurite growth, and neuronal differentiation. CC GPRFLN|REFERENCE 1 (residues 1 to 1997) CC GPRFLN| AUTHORS Adamsky,K., Schilling,J., Garwood,J., Faissner,A. and Peles,E. CC GPRFLN| TITLE Glial tumor cell adhesion is mediated by binding of the FNIII CC GPRFLN| domain of receptor protein tyrosine phosphatase beta (RPTPbeta) to CC GPRFLN| tenascin C CC GPRFLN| JOURNAL Oncogene 20 (5), 609-618 (2001) CC GPRFLN| MEDLINE 21214455 CC GPRFLN|REFERENCE 2 (residues 1 to 1997) CC GPRFLN| AUTHORS Ratcliffe,C.F., Qu,Y., McCormick,K.A., Tibbs,V.C., Dixon,J.E., CC GPRFLN| Scheuer,T. and Catterall,W.A. CC GPRFLN| TITLE A sodium channel signaling complex: modulation by associated CC GPRFLN| receptor protein tyrosine phosphatase beta CC GPRFLN| JOURNAL Nat. Neurosci. 3 (5), 437-444 (2000) CC GPRFLN| MEDLINE 20233995 CC GPRFLN|REFERENCE 3 (residues 1 to 1997) CC GPRFLN| AUTHORS Sakurai,T., Lustig,M., Nativ,M., Hemperly,J.J., Schlessinger,J., CC GPRFLN| Peles,E. and Grumet,M. CC GPRFLN| TITLE Induction of neurite outgrowth through contactin and Nr-CAM by CC GPRFLN| extracellular regions of glial receptor tyrosine phosphatase beta CC GPRFLN| JOURNAL J. Cell Biol. 136 (4), 907-918 (1997) CC GPRFLN| MEDLINE 97201469 CC GPRFLN|REFERENCE 4 (residues 1 to 1997) CC GPRFLN| AUTHORS Peles,E., Nativ,M., Campbell,P.L., Sakurai,T., Martinez,R., Lev,S., CC GPRFLN| Clary,D.O., Schilling,J., Barnea,G., Plowman,G.D. et al. CC GPRFLN| TITLE The carbonic anhydrase domain of receptor tyrosine phosphatase beta CC GPRFLN| is a functional ligand for the axonal cell recognition molecule CC GPRFLN| contactin CC GPRFLN| JOURNAL Cell 82 (2), 251-260 (1995) CC GPRFLN| MEDLINE 95354206 CC GPRFLN|REFERENCE 5 (residues 1 to 1997) CC GPRFLN| AUTHORS Harder,K.W., Anderson,L.L., Duncan,A.M. and Jirik,F.R. CC GPRFLN| TITLE The gene for receptor-like protein tyrosine phosphatase (PTPRB) is CC GPRFLN| assigned to chromosome 12q15-->q21 CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 61 (4), 269-270 (1992) CC GPRFLN| MEDLINE 93137605 CC GPRFLN|REFERENCE 6 (residues 1 to 1997) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC GPRFLN|REFERENCE 7 (residues 1 to 1997) CC GPRFLN| AUTHORS Kaplan,R., Morse,B., Huebner,K., Croce,C., Howk,R., Ravera,M., CC GPRFLN| Ricca,G., Jaye,M. and Schlessinger,J. CC GPRFLN| TITLE Cloning of three human tyrosine phosphatases reveals a multigene CC GPRFLN| family of receptor-linked protein-tyrosine-phosphatases expressed CC GPRFLN| in brain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (18), 7000-7004 (1990) CC GPRFLN| MEDLINE 90384936 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 280 VNTIFKEY:269 FT PROTEIN 1 280 protein tyrosine phosphatase, receptor type, beta polypeptide; protein tyrosine phosphatase beta FT VNTIFKEY:270 FT CHAIN 1 280 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 280 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 280 AA; NQFEGHFMKL QADSNYLLSK EYEELKDVGR NQSCDIALLP ENRGKNRYNN ILPYDATRVK 60 LSNVDDDPCS DYINASYIPG NNFRREYIVT QGPLPGTKDD FWKMVWEQNV HNIVMVTQCV 120 EKGRVKCDHY WPADQDSLYY GDLILQMLSE SVLPEWTIRE FKICGEEQLD AHRLIRHFHY 180 TVWPDHGVPE TTQSLIQFVR TVRDYINRSP GAGPTVVHCS AGVGRTGTFI ALDRILQQLD 240 SKDSVDIYGA VHDLRLHRVH MVQTECQYVY LHQCVRDVLR 280 // ID hPTPD1_D1\(NP_008970)\PTPN21 STANDARD;PRT; 292 AA. AC NP_008970; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 21; protein tyrosine phosphatase D1 [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X79510.1 and AI800682.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an N-terminal domain, CC similar to cytoskeletal- associated proteins including band 4.1, CC ezrin, merlin, and radixin. This PTP was shown to specially CC interact with BMX/ETK, a member of Tec tyrosine kinase family CC characterized by a multimodular structures including PH, SH3, and CC SH2 domains. The interaction of this PTP with BMX kinase was found CC to increase the activation of STAT3, but not STAT2 kinase. Studies CC of the similar gene in mice suggested the possible roles of this CC PTP in liver regeneration and spermatogenesis. CC GPRFLN|REFERENCE 1 (residues 1 to 1174) CC GPRFLN| AUTHORS Jui,H.Y., Tseng,R.J., Wen,X., Fang,H.I., Huang,L.M., Chen,K.Y., CC GPRFLN| Kung,H.J., Ann,D.K. and Shih,H.M. CC GPRFLN| TITLE Protein-tyrosine phosphatase D1, a potential regulator and effector CC GPRFLN| for Tec family kinases CC GPRFLN| JOURNAL J. Biol. Chem. 275 (52), 41124-41132 (2000) CC GPRFLN| MEDLINE 20576274 CC GPRFLN|REFERENCE 2 (residues 1 to 1174) CC GPRFLN| AUTHORS Tokuchi,H., Higashitsuji,H., Nishiyama,H., Nonoguchi,K., Nagao,T., CC GPRFLN| Xue,J.H., Itoh,K., Ogawa,O. and Fujita,J. CC GPRFLN| TITLE Expression of protein tyrosine phosphatase PTP-RL10 and its isoform CC GPRFLN| in the mouse testis CC GPRFLN| JOURNAL Int J Urol 6 (11), 572-577 (1999) CC GPRFLN| MEDLINE 20049818 CC GPRFLN|REFERENCE 3 (residues 1 to 1174) CC GPRFLN| AUTHORS Higashitsuji,H., Arii,S., Furutani,M., Imamura,M., Kaneko,Y., CC GPRFLN| Takenawa,J., Nakayama,H. and Fujita,J. CC GPRFLN| TITLE Enhanced expression of multiple protein tyrosine phosphatases in CC GPRFLN| the regenerating mouse liver: isolation of PTP-RL10, a novel CC GPRFLN| cytoplasmic-type phosphatase with sequence homology to cytoskeletal CC GPRFLN| protein 4.1 CC GPRFLN| JOURNAL Oncogene 10 (2), 407-414 (1995) CC GPRFLN| MEDLINE 95140431 CC GPRFLN|REFERENCE 4 (residues 1 to 1174) CC GPRFLN| AUTHORS Moller,N.P., Moller,K.B., Lammers,R., Kharitonenkov,A., Sures,I. CC GPRFLN| and Ullrich,A. CC GPRFLN| TITLE Src kinase associates with a member of a distinct subfamily of CC GPRFLN| protein-tyrosine phosphatases containing an ezrin-like domain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 91 (16), 7477-7481 (1994) CC GPRFLN| MEDLINE 94329538 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 292 VNTIFKEY:269 FT PROTEIN 1 292 protein tyrosine phosphatase D1 FT VNTIFKEY:270 FT REGION 18 292 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 292 AA; ATNDERCKIL EQRLEQGMVF TEYERILKKR LVDGECSTAR LPENAERNRF QDVLPYDDAR 60 VELVPTKENN TGYINASHIK VSVSGIEWDY IATQGPLQNT CQDFWQMVWE QGIAIIAMVT 120 AEEEGGREKS FRYWPRLGSR HNTVTYGRFK ITTRFRTDSG CYATTGLKMK HLLTGQERTV 180 WHLQYTDWPE HGCPEDLKGF LSYLEEIQSV RRHTNSTSDP QSPNPPLLVH CSAGVGRTGV 240 VILSEIMIAC LEHNEVLDIP RVLDMLRQQR MMLVQTLCQY TFVYRVLIQF LK 292 // ID hPTPD2_D1\(NP_005392)\PTPN14 STANDARD;PRT; 292 AA. AC NP_005392; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 14; cytoskeletal-associated protein tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X82676.1 and BC017300.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an N-terminal CC noncatalytic domain similar to that of band 4.1 superfamily CC cytoskeleton-associated proteins, which suggested the membrane or CC cytoskeleton localization of this protein. The specific function of CC this PTP has not yet been determined. CC GPRFLN|REFERENCE 1 (residues 1 to 1187) CC GPRFLN| AUTHORS Wadham,C., Gamble,J.R., Vadas,M.A. and Khew-Goodall,Y. CC GPRFLN| TITLE Translocation of protein tyrosine phosphatase Pez/PTPD2/PTP36 to CC GPRFLN| the nucleus is associated with induction of cell proliferation CC GPRFLN| JOURNAL J. Cell. Sci. 113 (Pt 17), 3117-3123 (2000) CC GPRFLN| MEDLINE 20394014 CC GPRFLN|REFERENCE 2 (residues 1 to 1187) CC GPRFLN| AUTHORS Aoyama,K., Matsuda,T. and Aoki,N. CC GPRFLN| TITLE Characterization of newly identified four isoforms for a putative CC GPRFLN| cytosolic protein tyrosine phosphatase PTP36 CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 266 (2), 523-531 (1999) CC GPRFLN| MEDLINE 20068798 CC GPRFLN|REFERENCE 3 (residues 1 to 1187) CC GPRFLN| AUTHORS Ogata,M., Takada,T., Mori,Y., Uchida,Y., Miki,T., Okuyama,A., CC GPRFLN| Kosugi,A., Sawada,M., Oh-hora,M. and Hamaoka,T. CC GPRFLN| TITLE Regulation of phosphorylation level and distribution of PTP36, a CC GPRFLN| putative protein tyrosine phosphatase, by cell-substrate adhesion CC GPRFLN| JOURNAL J. Biol. Chem. 274 (29), 20717-20724 (1999) CC GPRFLN| MEDLINE 99329094 CC GPRFLN|REFERENCE 4 (residues 1 to 1187) CC GPRFLN| AUTHORS Ogata,M., Takada,T., Mori,Y., Oh-hora,M., Uchida,Y., Kosugi,A., CC GPRFLN| Miyake,K. and Hamaoka,T. CC GPRFLN| TITLE Effects of overexpression of PTP36, a putative protein tyrosine CC GPRFLN| phosphatase, on cell adhesion, cell growth, and cytoskeletons in CC GPRFLN| HeLa cells CC GPRFLN| JOURNAL J. Biol. Chem. 274 (18), 12905-12909 (1999) CC GPRFLN| MEDLINE 99230323 CC GPRFLN|REFERENCE 5 (residues 1 to 1187) CC GPRFLN| AUTHORS Smith,A.L., Mitchell,P.J., Shipley,J., Gusterson,B.A., Rogers,M.V. CC GPRFLN| and Crompton,M.R. CC GPRFLN| TITLE Pez: a novel human cDNA encoding protein tyrosine phosphatase- and CC GPRFLN| ezrin-like domains CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 209 (3), 959-965 (1995) CC GPRFLN| MEDLINE 95251727 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 292 VNTIFKEY:269 FT PROTEIN 1 292 cytoskeletal-associated protein tyrosine phosphatase FT VNTIFKEY:270 FT REGION 18 292 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 292 AA; VPMDERFRTL KKKLEEGMVF TEYEQIPKKK ANGIFSTAAL PENAERSRIR EVVPYEENRV 60 ELIPTKENNT GYINASHIKV VVGGAEWHYI ATQGPLPHTC HDFWQMVWEQ GVNVIAMVTA 120 EEEGGRTKSH RYWPKLGSKH SSATYGKFKV TTKFRTDSVC YATTGLKVKH LLSGQERTVW 180 HLQYTDWPDH GCPEDVQGFL SYLEEIQSVR RHTNSMLEGT KNRHPPIVVH CSAGVGRTGV 240 LILSELMIYC LEHNEKVEVP MMLRLLREQR MFMIQTIAQY KFVYQVLIQF LQ 292 // ID hPTPdelta\_D1\(NP_002830)\PTPRD STANDARD;PRT; 275 AA. AC NP_002830; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, D isoform 1 precursor; protein tyrosine phosphatase, receptor type, delta polypeptide; protein tyrosine phosphatase delta [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L38929.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC region, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, thus represents a receptor-type CC PTP. The extracellular region of this protein is composed of three CC Ig-like and eight fibronectin type III-like domains. Studies of the CC similar genes in chick and fly suggest the role of this PTP is in CC promoting neurite growth, and regulating neurons axon guidance. CC Multiple tissue specific alternatively spliced transcript variants CC of this gene have been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1912) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1912) CC GPRFLN| AUTHORS Pulido,R., Serra-Pages,C., Tang,M. and Streuli,M. CC GPRFLN| TITLE The LAR/PTP delta/PTP sigma subfamily of transmembrane CC GPRFLN| protein-tyrosine-phosphatases: multiple human LAR, PTP delta, and CC GPRFLN| PTP sigma isoforms are expressed in a tissue-specific manner and CC GPRFLN| associate with the LAR-interacting protein LIP.1 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (25), 11686-11690 (1995) CC GPRFLN| MEDLINE 96102179 CC GPRFLN|REFERENCE 3 (residues 1 to 1912) CC GPRFLN| AUTHORS Pulido,R., Krueger,N.X., Serra-Pages,C., Saito,H. and Streuli,M. CC GPRFLN| TITLE Molecular characterization of the human transmembrane CC GPRFLN| protein-tyrosine phosphatase delta. Evidence for tissue-specific CC GPRFLN| expression of alternative human transmembrane protein-tyrosine CC GPRFLN| phosphatase delta isoforms CC GPRFLN| JOURNAL J. Biol. Chem. 270 (12), 6722-6728 (1995) CC GPRFLN| MEDLINE 95204468 CC GPRFLN|REFERENCE 4 (residues 1 to 1912) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 protein tyrosine phosphatase, receptor type, delta polypeptide; protein tyrosine phosphatase delta FT VNTIFKEY:270 FT CHAIN 1 275 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_4 SQ SEQUENCE 275 AA; LELADHIERL KANDNLKFSQ EYESIDPGQQ FTWEHSNLEV NKPKNRYANV IAYDHSRVLL 60 SAIEGIPGSD YVNANYIDGY RKQNAYIATQ GSLPETFGDF WRMIWEQRSA TVVMMTKLEE 120 RSRVKCDQYW PSRGTETHGL VQVTLLDTVE LATYCVRTFA LYKNGSSEKR EVRQFQFTAW 180 PDHGVPEHPT PFLAFLRRVK TCNPPDAGPM VVHCSAGVGR TGCFIVIDAM LERIKHEKTV 240 DIYGHVTLMR AQRNYMVQTE DQYIFIHDAL LEAVT 275 // ID hPTPdelta_D2\(NP_002830)\PTPRD STANDARD;PRT; 283 AA. AC NP_002830; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, D isoform 1 precursor; protein tyrosine phosphatase, receptor type, delta polypeptide; protein tyrosine phosphatase delta [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L38929.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC region, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, thus represents a receptor-type CC PTP. The extracellular region of this protein is composed of three CC Ig-like and eight fibronectin type III-like domains. Studies of the CC similar genes in chick and fly suggest the role of this PTP is in CC promoting neurite growth, and regulating neurons axon guidance. CC Multiple tissue specific alternatively spliced transcript variants CC of this gene have been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1912) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1912) CC GPRFLN| AUTHORS Pulido,R., Serra-Pages,C., Tang,M. and Streuli,M. CC GPRFLN| TITLE The LAR/PTP delta/PTP sigma subfamily of transmembrane CC GPRFLN| protein-tyrosine-phosphatases: multiple human LAR, PTP delta, and CC GPRFLN| PTP sigma isoforms are expressed in a tissue-specific manner and CC GPRFLN| associate with the LAR-interacting protein LIP.1 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (25), 11686-11690 (1995) CC GPRFLN| MEDLINE 96102179 CC GPRFLN|REFERENCE 3 (residues 1 to 1912) CC GPRFLN| AUTHORS Pulido,R., Krueger,N.X., Serra-Pages,C., Saito,H. and Streuli,M. CC GPRFLN| TITLE Molecular characterization of the human transmembrane CC GPRFLN| protein-tyrosine phosphatase delta. Evidence for tissue-specific CC GPRFLN| expression of alternative human transmembrane protein-tyrosine CC GPRFLN| phosphatase delta isoforms CC GPRFLN| JOURNAL J. Biol. Chem. 270 (12), 6722-6728 (1995) CC GPRFLN| MEDLINE 95204468 CC GPRFLN|REFERENCE 4 (residues 1 to 1912) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein tyrosine phosphatase, receptor type, delta polypeptide; protein tyrosine phosphatase delta FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 21 282 PTPc FT VNTIFKEY:266; VNTINAME:Region_5 SQ SEQUENCE 283 AA; RNLYAYIQKL TQIETGENVT GMELEFKRLA SSKAHTSRFI SANLPCNKFK NRLVNIMPYE 60 STRVCLQPIR GVEGSDYINA SFIDGYRQQK AYIATQGPLA ETTEDFWRML WEHNSTIVVM 120 LTKLREMGRE KCHQYWPAER SARYQYFVVD PMAEYNMPQY ILREFKVTDA RDGQSRTVRQ 180 FQFTDWPEQG VPKSGEGFID FIGQVHKTKE QFGQDGPISV HCSAGVGRTG VFITLSIVLE 240 RMRYEGVVDI FQTVKMLRTQ RPAMVQTEDQ YQFSYRAALE YLG 283 // ID hPTPepsilon_D1\(NP_006495)\PTPRE STANDARD;PRT; 279 AA. AC NP_006495; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, E isoform 1 precursor; protein tyrosine phosphatase, receptor type, epsilon; protein tyrosine phosphatase, receptor type, epsilon polypeptide; protein tyrosine phosphatase epsilon [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X54134.1, AJ315969.1 and CC BI559814.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. Two alternatively spliced transcript CC variants of this gene have been reported, one of which encodes a CC receptor-type PTP that possesses a short extracellular domain, a CC single transmembrane region, and two tandem intracytoplasmic CC catalytic domains; Another one encodes a PTP that contains a CC distinct hydrophilic N-terminus, and thus represents a CC nonreceptor-type isoform of this PTP. Studies of the similar gene CC in mice suggested the regulatory roles of this PTP in RAS related CC signal transduction pathways, cytokines induced SATA signaling, as CC well as the activation of voltage-gated K+ channels. CC CC Transcript Variant: This variant (1) contains a different 5' end CC region that includes a part of the coding region, when compared to CC variant 2. It thus encodes a protein that has a distinct CC N-terminus, as compared to isoform 2. The encoded protein is a CC receptor type isoform of this PTP. CC GPRFLN|REFERENCE 1 (residues 1 to 700) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 700) CC GPRFLN| AUTHORS Wabakken,T., Hauge,H., Funderud,S. and Aasheim,H.C. CC GPRFLN| TITLE Characterization, expression and functional aspects of a novel CC GPRFLN| protein tyrosine phosphatase epsilon isoform CC GPRFLN| JOURNAL Scand. J. Immunol. 56 (3), 276-285 (2002) CC GPRFLN| MEDLINE 22181756 CC GPRFLN| REMARK GeneRIF: Characterization, expression and functional aspects of an CC GPRFLN| alternative spliced isoform of protein tyrosine phosphatase epsilon CC GPRFLN|REFERENCE 3 (residues 1 to 700) CC GPRFLN| AUTHORS Wabakken,T., Hauge,H., Finne,E.F., Wiedlocha,A. and Aasheim,H. CC GPRFLN| TITLE Expression of human protein tyrosine phosphatase epsilon in CC GPRFLN| leucocytes: a potential ERK pathway-regulating phosphatase CC GPRFLN| JOURNAL Scand. J. Immunol. 56 (2), 195-203 (2002) CC GPRFLN| MEDLINE 22118122 CC GPRFLN| REMARK GeneRIF: Transfection of cells with different PTPepsilon constructs CC GPRFLN| and activator protein-1 reporter gene indicates that the catalytic CC GPRFLN| activity of PTPepsilon is involved in the regulation of the CC GPRFLN| mitogen-activated protein kinase cascade. CC GPRFLN|REFERENCE 4 (residues 1 to 700) CC GPRFLN| AUTHORS Tanuma,N., Nakamura,K., Shima,H. and Kikuchi,K. CC GPRFLN| TITLE Protein-tyrosine phosphatase PTPepsilon C inhibits Jak-STAT CC GPRFLN| signaling and differentiation induced by interleukin-6 and leukemia CC GPRFLN| inhibitory factor in M1 leukemia cells CC GPRFLN| JOURNAL J. Biol. Chem. 275 (36), 28216-28221 (2000) CC GPRFLN| MEDLINE 20428741 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 5 (residues 1 to 700) CC GPRFLN| AUTHORS Peretz,A., Gil-Henn,H., Sobko,A., Shinder,V., Attali,B. and CC GPRFLN| Elson,A. CC GPRFLN| TITLE Hypomyelination and increased activity of voltage-gated K(+) CC GPRFLN| channels in mice lacking protein tyrosine phosphatase epsilon CC GPRFLN| JOURNAL EMBO J. 19 (15), 4036-4045 (2000) CC GPRFLN| MEDLINE 20380937 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 6 (residues 1 to 700) CC GPRFLN| AUTHORS Toledano-Katchalski,H. and Elson,A. CC GPRFLN| TITLE The transmembranal and cytoplasmic forms of protein tyrosine CC GPRFLN| phosphatase epsilon physically associate with the adaptor molecule CC GPRFLN| Grb2 CC GPRFLN| JOURNAL Oncogene 18 (36), 5024-5031 (1999) CC GPRFLN| MEDLINE 99422037 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 7 (residues 1 to 700) CC GPRFLN| AUTHORS Elson,A. and Leder,P. CC GPRFLN| TITLE Identification of a cytoplasmic, phorbol ester-inducible isoform of CC GPRFLN| protein tyrosine phosphatase epsilon CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (26), 12235-12239 (1995) CC GPRFLN| MEDLINE 96109240 CC GPRFLN|REFERENCE 8 (residues 1 to 700) CC GPRFLN| AUTHORS van den Maagdenberg,A.M., van den Hurk,H.H., Weghuis,D., CC GPRFLN| Wieringa,B., Geurts van Kessel,A. and Hendriks,W.J. CC GPRFLN| TITLE Assignment of the human protein tyrosine phosphatase epsilon CC GPRFLN| (PTPRE) gene to chromosome 10q26 by fluorescence in situ CC GPRFLN| hybridization CC GPRFLN| JOURNAL Genomics 30 (1), 128-129 (1995) CC GPRFLN| MEDLINE 96129319 CC GPRFLN|REFERENCE 9 (residues 1 to 700) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 protein tyrosine phosphatase, receptor type, epsilon; protein tyrosine phosphatase, receptor type, epsilon polypeptide; protein tyrosine phosphatase epsilon FT VNTIFKEY:270 FT CHAIN 1 279 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 279 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; EHLEEEIRIR SADDCKQFRE EFNSLPSGHI QGTFELANKE ENREKNRYPN ILPNDHSRVI 60 LSQLDGIPCS DYINASYIDG YKEKNKFIAA QGPKQETVND FWRMVWEQKS ATIVMLTNLK 120 ERKEEKCHQY WPDQGCWTYG NIRVCVEDCV VLVDYTIRKF CIQPQLPDGC KAPRLVSQLH 180 FTSWPDFGVP FTPIGMLKFL KKVKTLNPVH AGPIVVHCSA GVGRTGTFIV IDAMMAMMHA 240 EQKVDVFEFV SRIRNQRPQM VQTDMQYTFI YQALLEYYL 279 // ID hPTPepsilon_D2\(NP_006495)\PTPRE STANDARD;PRT; 287 AA. AC NP_006495; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, E isoform 1 precursor; protein tyrosine phosphatase, receptor type, epsilon; protein tyrosine phosphatase, receptor type, epsilon polypeptide; protein tyrosine phosphatase epsilon [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X54134.1, AJ315969.1 and CC BI559814.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. Two alternatively spliced transcript CC variants of this gene have been reported, one of which encodes a CC receptor-type PTP that possesses a short extracellular domain, a CC single transmembrane region, and two tandem intracytoplasmic CC catalytic domains; Another one encodes a PTP that contains a CC distinct hydrophilic N-terminus, and thus represents a CC nonreceptor-type isoform of this PTP. Studies of the similar gene CC in mice suggested the regulatory roles of this PTP in RAS related CC signal transduction pathways, cytokines induced SATA signaling, as CC well as the activation of voltage-gated K+ channels. CC CC Transcript Variant: This variant (1) contains a different 5' end CC region that includes a part of the coding region, when compared to CC variant 2. It thus encodes a protein that has a distinct CC N-terminus, as compared to isoform 2. The encoded protein is a CC receptor type isoform of this PTP. CC GPRFLN|REFERENCE 1 (residues 1 to 700) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 700) CC GPRFLN| AUTHORS Wabakken,T., Hauge,H., Funderud,S. and Aasheim,H.C. CC GPRFLN| TITLE Characterization, expression and functional aspects of a novel CC GPRFLN| protein tyrosine phosphatase epsilon isoform CC GPRFLN| JOURNAL Scand. J. Immunol. 56 (3), 276-285 (2002) CC GPRFLN| MEDLINE 22181756 CC GPRFLN| REMARK GeneRIF: Characterization, expression and functional aspects of an CC GPRFLN| alternative spliced isoform of protein tyrosine phosphatase epsilon CC GPRFLN|REFERENCE 3 (residues 1 to 700) CC GPRFLN| AUTHORS Wabakken,T., Hauge,H., Finne,E.F., Wiedlocha,A. and Aasheim,H. CC GPRFLN| TITLE Expression of human protein tyrosine phosphatase epsilon in CC GPRFLN| leucocytes: a potential ERK pathway-regulating phosphatase CC GPRFLN| JOURNAL Scand. J. Immunol. 56 (2), 195-203 (2002) CC GPRFLN| MEDLINE 22118122 CC GPRFLN| REMARK GeneRIF: Transfection of cells with different PTPepsilon constructs CC GPRFLN| and activator protein-1 reporter gene indicates that the catalytic CC GPRFLN| activity of PTPepsilon is involved in the regulation of the CC GPRFLN| mitogen-activated protein kinase cascade. CC GPRFLN|REFERENCE 4 (residues 1 to 700) CC GPRFLN| AUTHORS Tanuma,N., Nakamura,K., Shima,H. and Kikuchi,K. CC GPRFLN| TITLE Protein-tyrosine phosphatase PTPepsilon C inhibits Jak-STAT CC GPRFLN| signaling and differentiation induced by interleukin-6 and leukemia CC GPRFLN| inhibitory factor in M1 leukemia cells CC GPRFLN| JOURNAL J. Biol. Chem. 275 (36), 28216-28221 (2000) CC GPRFLN| MEDLINE 20428741 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 5 (residues 1 to 700) CC GPRFLN| AUTHORS Peretz,A., Gil-Henn,H., Sobko,A., Shinder,V., Attali,B. and CC GPRFLN| Elson,A. CC GPRFLN| TITLE Hypomyelination and increased activity of voltage-gated K(+) CC GPRFLN| channels in mice lacking protein tyrosine phosphatase epsilon CC GPRFLN| JOURNAL EMBO J. 19 (15), 4036-4045 (2000) CC GPRFLN| MEDLINE 20380937 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 6 (residues 1 to 700) CC GPRFLN| AUTHORS Toledano-Katchalski,H. and Elson,A. CC GPRFLN| TITLE The transmembranal and cytoplasmic forms of protein tyrosine CC GPRFLN| phosphatase epsilon physically associate with the adaptor molecule CC GPRFLN| Grb2 CC GPRFLN| JOURNAL Oncogene 18 (36), 5024-5031 (1999) CC GPRFLN| MEDLINE 99422037 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 7 (residues 1 to 700) CC GPRFLN| AUTHORS Elson,A. and Leder,P. CC GPRFLN| TITLE Identification of a cytoplasmic, phorbol ester-inducible isoform of CC GPRFLN| protein tyrosine phosphatase epsilon CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (26), 12235-12239 (1995) CC GPRFLN| MEDLINE 96109240 CC GPRFLN|REFERENCE 8 (residues 1 to 700) CC GPRFLN| AUTHORS van den Maagdenberg,A.M., van den Hurk,H.H., Weghuis,D., CC GPRFLN| Wieringa,B., Geurts van Kessel,A. and Hendriks,W.J. CC GPRFLN| TITLE Assignment of the human protein tyrosine phosphatase epsilon CC GPRFLN| (PTPRE) gene to chromosome 10q26 by fluorescence in situ CC GPRFLN| hybridization CC GPRFLN| JOURNAL Genomics 30 (1), 128-129 (1995) CC GPRFLN| MEDLINE 96129319 CC GPRFLN|REFERENCE 9 (residues 1 to 700) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 287 VNTIFKEY:269 FT PROTEIN 1 287 protein tyrosine phosphatase, receptor type, epsilon; protein tyrosine phosphatase, receptor type, epsilon polypeptide; protein tyrosine phosphatase epsilon FT VNTIFKEY:270 FT CHAIN 1 287 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 21 286 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 287 AA; SSLEKHLQTM HGTTTHFDKI GLEEEFRKLT NVRIMKENMR TGNLPANMKK ARVIQIIPYD 60 FNRVILSMKR GQEYTDYINA SFIDGYRQKD YFIATQGPLA HTVEDFWRMI WEWKSHTIVM 120 LTEVQEREQD KCYQYWPTEG SVTHGEITIE IKNDTLSEAI SIRDFLVTLN QPQARQEEQV 180 RVVRQFHFHG WPEIGIPAEG KGMIDLIAAV QKQQQQTGNH PITVHCSAGA GRTGTFIALS 240 NILERVKAEG LLDVFQAVKS LRLQRPHMVQ TLEQYEFCYK VVQDFID 287 // ID hPTPgamma_D1\(NP_002832)\PTPRG STANDARD;PRT; 291 AA. AC NP_002832; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, G precursor; protein tyrosine phosphatase, receptor type, gamma polypeptide; protein tyrosine phosphatase gamma; receptor-type protein phosphatase gamma; receptor tyrosine phosphatase gamma [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L09247.1, AI872451.1 and CC U46089.1. CC On Feb 22, 2002 this sequence version replaced gi:11386169. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. The extracellular region of this PTP contains a CC carbonic anhydrase-like (CAH) domain, which is also found in the CC extracellular region of PTPRBETA/ZETA. This gene is located in a CC chromosomal region that is frequently deleted in renal cell CC carcinoma and lung carcinoma, thus is thought to be a candidate CC tumor suppressor gene. CC GPRFLN|REFERENCE 1 (residues 1 to 1445) CC GPRFLN| AUTHORS Liu,S., Sugimoto,Y., Kulp,S.K., Jiang,J., Chang,H.L., Park,K.Y., CC GPRFLN| Kashida,Y. and Lin,Y.C. CC GPRFLN| TITLE Estrogenic down-regulation of protein tyrosine phosphatase gamma CC GPRFLN| (PTP gamma) in human breast is associated with estrogen receptor CC GPRFLN| alpha CC GPRFLN| JOURNAL Anticancer Res. 22 (6C), 3917-3923 (2002) CC GPRFLN| MEDLINE 22441179 CC GPRFLN| REMARK GeneRIF: Estrogenic down-regulation of protein tyrosine phosphatase CC GPRFLN| gamma (PTP gamma) in human breast is associated with estrogen CC GPRFLN| receptor alpha. CC GPRFLN|REFERENCE 2 (residues 1 to 1445) CC GPRFLN| AUTHORS Liu,S., Kulp,S.K., Sugimoto,Y., Jiang,J., Chang,H.L. and Lin,Y.C. CC GPRFLN| TITLE Involvement of breast epithelial-stromal interactions in the CC GPRFLN| regulation of protein tyrosine phosphatase-gamma (PTPgamma) mRNA CC GPRFLN| expression by estrogenically active agents CC GPRFLN| JOURNAL Breast Cancer Res. Treat. 71 (1), 21-35 (2002) CC GPRFLN| MEDLINE 21848634 CC GPRFLN| REMARK GeneRIF: both estradiol-17beta and zeranol regulate PTPgamma CC GPRFLN| expression in human breast; epithelial-stromal cell interaction is CC GPRFLN| important in regulation of PTPgamma expression by estrogenically CC GPRFLN| active agents CC GPRFLN|REFERENCE 3 (residues 1 to 1445) CC GPRFLN| AUTHORS Kastury,K., Ohta,M., Lasota,J., Moir,D., Dorman,T., LaForgia,S., CC GPRFLN| Druck,T. and Huebner,K. CC GPRFLN| TITLE Structure of the human receptor tyrosine phosphatase gamma gene CC GPRFLN| (PTPRG) and relation to the familial RCC t(3;8) chromosome CC GPRFLN| translocation CC GPRFLN| JOURNAL Genomics 32 (2), 225-235 (1996) CC GPRFLN| MEDLINE 96429999 CC GPRFLN|REFERENCE 4 (residues 1 to 1445) CC GPRFLN| AUTHORS Barnea,G., Silvennoinen,O., Shaanan,B., Honegger,A.M., Canoll,P.D., CC GPRFLN| D'Eustachio,P., Morse,B., Levy,J.B., Laforgia,S., Huebner,K. et al. CC GPRFLN| TITLE Identification of a carbonic anhydrase-like domain in the CC GPRFLN| extracellular region of RPTP gamma defines a new subfamily of CC GPRFLN| receptor tyrosine phosphatases CC GPRFLN| JOURNAL Mol. Cell. Biol. 13 (3), 1497-1506 (1993) CC GPRFLN| MEDLINE 93180796 CC GPRFLN|REFERENCE 5 (residues 1 to 1445) CC GPRFLN| AUTHORS LaForgia,S., Morse,B., Levy,J., Barnea,G., Cannizzaro,L.A., Li,F., CC GPRFLN| Nowell,P.C., Boghosian-Sell,L., Glick,J., Weston,A. et al. CC GPRFLN| TITLE Receptor protein-tyrosine phosphatase gamma is a candidate tumor CC GPRFLN| suppressor gene at human chromosome region 3p21 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (11), 5036-5040 (1991) CC GPRFLN| MEDLINE 91271326 CC GPRFLN|REFERENCE 6 (residues 1 to 1445) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 291 VNTIFKEY:269 FT PROTEIN 1 291 protein tyrosine phosphatase, receptor type, gamma polypeptide; protein tyrosine phosphatase gamma; receptor-type protein phosphatase gamma; receptor tyrosine phosphatase gamma FT VNTIFKEY:270 FT CHAIN 1 291 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 291 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 291 AA; KQFVKHIGEL YSNNQHGFSE DFEEVQRCTA DMNITAEHSN HPENKHKNRY INILAYDHSR 60 VKLRPLPGKD SKHSDYINAN YVDGYNKAKA YIATQGPLKS TFEDFWRMIW EQNTGIIVMI 120 TNLVEKGRRK CDQYWPTENS EEYGNIIVTL KSTKIHACYT VRRFSIRNTK VKKGQKGNPK 180 GRQNERVVIQ YHYTQWPDMG VPEYALPVLT FVRRSSAARM PETGPVLVHC SAGVGRTGTY 240 IVIDSMLQQI KDKSTVNVLG FLKHIRTQRN YLVQTEEQYI FIHDALLEAI L 291 // ID hPTPgamma_D2\(NP_002832)\PTPRG STANDARD;PRT; 283 AA. AC NP_002832; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, G precursor; protein tyrosine phosphatase, receptor type, gamma polypeptide; protein tyrosine phosphatase gamma; receptor-type protein phosphatase gamma; receptor tyrosine phosphatase gamma [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L09247.1, AI872451.1 and CC U46089.1. CC On Feb 22, 2002 this sequence version replaced gi:11386169. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. The extracellular region of this PTP contains a CC carbonic anhydrase-like (CAH) domain, which is also found in the CC extracellular region of PTPRBETA/ZETA. This gene is located in a CC chromosomal region that is frequently deleted in renal cell CC carcinoma and lung carcinoma, thus is thought to be a candidate CC tumor suppressor gene. CC GPRFLN|REFERENCE 1 (residues 1 to 1445) CC GPRFLN| AUTHORS Liu,S., Sugimoto,Y., Kulp,S.K., Jiang,J., Chang,H.L., Park,K.Y., CC GPRFLN| Kashida,Y. and Lin,Y.C. CC GPRFLN| TITLE Estrogenic down-regulation of protein tyrosine phosphatase gamma CC GPRFLN| (PTP gamma) in human breast is associated with estrogen receptor CC GPRFLN| alpha CC GPRFLN| JOURNAL Anticancer Res. 22 (6C), 3917-3923 (2002) CC GPRFLN| MEDLINE 22441179 CC GPRFLN| REMARK GeneRIF: Estrogenic down-regulation of protein tyrosine phosphatase CC GPRFLN| gamma (PTP gamma) in human breast is associated with estrogen CC GPRFLN| receptor alpha. CC GPRFLN|REFERENCE 2 (residues 1 to 1445) CC GPRFLN| AUTHORS Liu,S., Kulp,S.K., Sugimoto,Y., Jiang,J., Chang,H.L. and Lin,Y.C. CC GPRFLN| TITLE Involvement of breast epithelial-stromal interactions in the CC GPRFLN| regulation of protein tyrosine phosphatase-gamma (PTPgamma) mRNA CC GPRFLN| expression by estrogenically active agents CC GPRFLN| JOURNAL Breast Cancer Res. Treat. 71 (1), 21-35 (2002) CC GPRFLN| MEDLINE 21848634 CC GPRFLN| REMARK GeneRIF: both estradiol-17beta and zeranol regulate PTPgamma CC GPRFLN| expression in human breast; epithelial-stromal cell interaction is CC GPRFLN| important in regulation of PTPgamma expression by estrogenically CC GPRFLN| active agents CC GPRFLN|REFERENCE 3 (residues 1 to 1445) CC GPRFLN| AUTHORS Kastury,K., Ohta,M., Lasota,J., Moir,D., Dorman,T., LaForgia,S., CC GPRFLN| Druck,T. and Huebner,K. CC GPRFLN| TITLE Structure of the human receptor tyrosine phosphatase gamma gene CC GPRFLN| (PTPRG) and relation to the familial RCC t(3;8) chromosome CC GPRFLN| translocation CC GPRFLN| JOURNAL Genomics 32 (2), 225-235 (1996) CC GPRFLN| MEDLINE 96429999 CC GPRFLN|REFERENCE 4 (residues 1 to 1445) CC GPRFLN| AUTHORS Barnea,G., Silvennoinen,O., Shaanan,B., Honegger,A.M., Canoll,P.D., CC GPRFLN| D'Eustachio,P., Morse,B., Levy,J.B., Laforgia,S., Huebner,K. et al. CC GPRFLN| TITLE Identification of a carbonic anhydrase-like domain in the CC GPRFLN| extracellular region of RPTP gamma defines a new subfamily of CC GPRFLN| receptor tyrosine phosphatases CC GPRFLN| JOURNAL Mol. Cell. Biol. 13 (3), 1497-1506 (1993) CC GPRFLN| MEDLINE 93180796 CC GPRFLN|REFERENCE 5 (residues 1 to 1445) CC GPRFLN| AUTHORS LaForgia,S., Morse,B., Levy,J., Barnea,G., Cannizzaro,L.A., Li,F., CC GPRFLN| Nowell,P.C., Boghosian-Sell,L., Glick,J., Weston,A. et al. CC GPRFLN| TITLE Receptor protein-tyrosine phosphatase gamma is a candidate tumor CC GPRFLN| suppressor gene at human chromosome region 3p21 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (11), 5036-5040 (1991) CC GPRFLN| MEDLINE 91271326 CC GPRFLN|REFERENCE 6 (residues 1 to 1445) CC GPRFLN| AUTHORS Krueger,N.X., Streuli,M. and Saito,H. CC GPRFLN| TITLE Structural diversity and evolution of human receptor-like protein CC GPRFLN| tyrosine phosphatases CC GPRFLN| JOURNAL EMBO J. 9 (10), 3241-3252 (1990) CC GPRFLN| MEDLINE 91006018 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein tyrosine phosphatase, receptor type, gamma polypeptide; protein tyrosine phosphatase gamma; receptor-type protein phosphatase gamma; receptor tyrosine phosphatase gamma FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 21 283 PTPc FT VNTIFKEY:266; VNTINAME:Region_3 SQ SEQUENCE 283 AA; NQLHSYVNSI LIPGVGGKTR LEKQFKLVTQ CNAKYVECFS AQKECNKEKN RNSSVVPSER 60 ARVGLAPLPG MKGTDYINAS YIMGYYRSNE FIITQHPLPH TTKDFWRMIW DHNAQIIVML 120 PDNQSLAEDE FVYWPSREES MNCEAFTVTL ISKDRLCLSN EEQIIIHDFI LEATQDDYVL 180 EVRHFQCPKW PNPDAPISST FELINVIKEE ALTRDGPTIV HDEYGAVSAG MLCALTTLSQ 240 QLENENAVDV FQVAKMINLM RPGVFTDIEQ YQFIYKARLS LVS 283 // ID hPTPH1_D1\(NP_002820)\PTPN3 STANDARD;PRT; 276 AA. AC NP_002820; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 3; protein tyrosin phosphatase H1; cytoskeletal-associated protein tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M64572.1 and W15441.1. CC On Jan 10, 2002 this sequence version replaced gi:4506293. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This protein contains a C-terminal PTP CC domain and an N-terminal domain homologous to the band 4.1 CC superfamily of cytoskeletal-associated proteins. P97, a cell cycle CC regulator involved in a variety of membrane related functions, has CC been shown to be a substrate of this PTP. This PTP was also found CC to interact with, and be regulated by adaptor protein 14-3-3 beta. CC GPRFLN|REFERENCE 1 (residues 1 to 913) CC GPRFLN| AUTHORS Zheng,Y., Schlondorff,J. and Blobel,C.P. CC GPRFLN| TITLE Evidence for regulation of the tumor necrosis factor CC GPRFLN| alpha-convertase (TACE) by protein-tyrosine phosphatase PTPH1 CC GPRFLN| JOURNAL J. Biol. Chem. 277 (45), 42463-42470 (2002) CC GPRFLN| MEDLINE 22301977 CC GPRFLN| REMARK GeneRIF: regulates TACE (tnf-alpha convertase} CC GPRFLN|REFERENCE 2 (residues 1 to 913) CC GPRFLN| AUTHORS Zhang,S.H., Liu,J., Kobayashi,R. and Tonks,N.K. CC GPRFLN| TITLE Identification of the cell cycle regulator VCP (p97/CDC48) as a CC GPRFLN| substrate of the band 4.1-related protein-tyrosine phosphatase CC GPRFLN| PTPH1 CC GPRFLN| JOURNAL J. Biol. Chem. 274 (25), 17806-17812 (1999) CC GPRFLN| MEDLINE 99292748 CC GPRFLN|REFERENCE 3 (residues 1 to 913) CC GPRFLN| AUTHORS Zhang,S.H., Kobayashi,R., Graves,P.R., Piwnica-Worms,H. and CC GPRFLN| Tonks,N.K. CC GPRFLN| TITLE Serine phosphorylation-dependent association of the band CC GPRFLN| 4.1-related protein-tyrosine phosphatase PTPH1 with 14-3-3beta CC GPRFLN| protein CC GPRFLN| JOURNAL J. Biol. Chem. 272 (43), 27281-27287 (1997) CC GPRFLN| MEDLINE 98001710 CC GPRFLN|REFERENCE 4 (residues 1 to 913) CC GPRFLN| AUTHORS Ikuta,S., Itoh,F., Hinoda,Y., Toyota,M., Makiguchi,Y., Imai,K. and CC GPRFLN| Yachi,A. CC GPRFLN| TITLE Expression of cytoskeletal-associated protein tyrosine phosphatase CC GPRFLN| PTPH1 mRNA in human hepatocellular carcinoma CC GPRFLN| JOURNAL J. Gastroenterol. 29 (6), 727-732 (1994) CC GPRFLN| MEDLINE 95179278 CC GPRFLN|REFERENCE 5 (residues 1 to 913) CC GPRFLN| AUTHORS Itoh,F., Ikuta,S., Hinoda,Y., Arimura,Y., Ohe,M., Adachi,M., CC GPRFLN| Ariyama,T., Inazawa,J., Imai,K. and Yachi,A. CC GPRFLN| TITLE Expression and chromosomal assignment of PTPH1 gene encoding a CC GPRFLN| cytosolic protein tyrosine phosphatase homologous to CC GPRFLN| cytoskeletal-associated proteins CC GPRFLN| JOURNAL Int. J. Cancer 55 (6), 947-951 (1993) CC GPRFLN| MEDLINE 94075060 CC GPRFLN|REFERENCE 6 (residues 1 to 913) CC GPRFLN| AUTHORS Arimura,Y., Hinoda,Y., Itoh,F., Takekawa,M., Tsujisaki,M., CC GPRFLN| Adachi,M., Imai,K. and Yachi,A. CC GPRFLN| TITLE cDNA cloning of new protein tyrosine phosphatases in the human CC GPRFLN| colon CC GPRFLN| JOURNAL Tumour Biol. 13 (3), 180-186 (1992) CC GPRFLN| MEDLINE 92327504 CC GPRFLN|REFERENCE 7 (residues 1 to 913) CC GPRFLN| AUTHORS Yang,Q. and Tonks,N.K. CC GPRFLN| TITLE Isolation of a cDNA clone encoding a human protein-tyrosine CC GPRFLN| phosphatase with homology to the cytoskeletal-associated proteins CC GPRFLN| band 4.1, ezrin, and talin CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (14), 5949-5953 (1991) CC GPRFLN| MEDLINE 91296738 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 276 VNTIFKEY:269 FT PROTEIN 1 276 protein tyrosin phosphatase H1; cytoskeletal-associated protein tyrosine phosphatase FT VNTIFKEY:270 FT REGION 22 276 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 276 AA; DTLEGSMAQL KKGLESGTVL IQFEQLYRKK PGLAITFAKL PQNLDKNRYK DVLPYDTTRV 60 LLQGNEDYIN ASYVNMEIPA ANLVNKYIAT QGPLPHTCAQ FWQVVWDQKL SLIVMLTTLT 120 ERGRTKCHQY WPDPPDVMNH GGFHIQCQSE DCTIAYVSRE MLVTNTQTGE EHTVTHLQYV 180 AWPDHGVPDD SSDFLEFVNY VRSLRVDSEP LLVHCSAGIG RTGVLVTMET AMCLTERNLP 240 IYPLDIVRKM RDQRAMMVQT SSQYKFVCEA ILRVYE 276 // ID hPTPkappa_D1\(NP_002835)\PTPRK STANDARD;PRT; 274 AA. AC NP_002835; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, K precursor; protein-tyrosine phosphatase, receptor type, kappa; protein-tyrosine phosphatase kappa; protein-tyrosine phosphatase kappa precursor [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L77886.1 and BI755683.1. CC On Feb 22, 2002 this sequence version replaced gi:4506317. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem catalytic CC domains, and thus represents a receptor-type PTP. The extracellular CC region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like CC domain and four fibronectin type III-like repeats. This PTP was CC shown to mediate homophilic intercellular interaction, possibly CC through the interaction with beta- and gamma-catenin at adherens CC junctions. Expression of this gene was found to be stimulated by CC TGF-beta 1, which may be important for the inhibition of CC keratinocyte proliferation. CC GPRFLN|REFERENCE 1 (residues 1 to 1440) CC GPRFLN| AUTHORS Yang,Y., Gil,M.C., Choi,E.Y., Park,S.H., Pyun,K.H. and Ha,H. CC GPRFLN| TITLE Molecular cloning and chromosomal localization of a human gene CC GPRFLN| homologous to the murine R-PTP-kappa, a receptor-type protein CC GPRFLN| tyrosine phosphatase CC GPRFLN| JOURNAL Gene 186 (1), 77-82 (1997) CC GPRFLN| MEDLINE 97199372 CC GPRFLN|REFERENCE 2 (residues 1 to 1440) CC GPRFLN| AUTHORS Yang,Y., Gil,M., Byun,S.M., Choi,I., Pyun,K.H. and Ha,H. CC GPRFLN| TITLE Transforming growth factor-beta1 inhibits human keratinocyte CC GPRFLN| proliferation by upregulation of a receptor-type tyrosine CC GPRFLN| phosphatase R-PTP-kappa gene expression CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 228 (3), 807-812 (1996) CC GPRFLN| MEDLINE 97096334 CC GPRFLN|REFERENCE 3 (residues 1 to 1440) CC GPRFLN| AUTHORS Fuchs,M., Muller,T., Lerch,M.M. and Ullrich,A. CC GPRFLN| TITLE Association of human protein-tyrosine phosphatase kappa with CC GPRFLN| members of the armadillo family CC GPRFLN| JOURNAL J. Biol. Chem. 271 (28), 16712-16719 (1996) CC GPRFLN| MEDLINE 96279245 CC GPRFLN|REFERENCE 4 (residues 1 to 1440) CC GPRFLN| AUTHORS Zondag,G.C., Koningstein,G.M., Jiang,Y.P., Sap,J., Moolenaar,W.H. CC GPRFLN| and Gebbink,M.F. CC GPRFLN| TITLE Homophilic interactions mediated by receptor tyrosine phosphatases CC GPRFLN| mu and kappa. A critical role for the novel extracellular MAM CC GPRFLN| domain CC GPRFLN| JOURNAL J. Biol. Chem. 270 (24), 14247-14250 (1995) CC GPRFLN| MEDLINE 95301498 CC GPRFLN|REFERENCE 5 (residues 1 to 1440) CC GPRFLN| AUTHORS Sap,J., Jiang,Y.P., Friedlander,D., Grumet,M. and Schlessinger,J. CC GPRFLN| TITLE Receptor tyrosine phosphatase R-PTP-kappa mediates homophilic CC GPRFLN| binding CC GPRFLN| JOURNAL Mol. Cell. Biol. 14 (1), 1-9 (1994) CC GPRFLN| MEDLINE 94088505 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 274 VNTIFKEY:269 FT PROTEIN 1 274 protein-tyrosine phosphatase, receptor type, kappa; protein-tyrosine phosphatase kappa; protein-tyrosine phosphatase kappa precursor FT VNTIFKEY:270 FT CHAIN 1 274 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 274 AA; ADLLQHINLM KTSDSYGFKE EYESFFEGQS ASWDVAKKDQ NRAKNRYGNI IAYDHSRVIL 60 QPVEDDPSSD YINANYIDGY QRPSHYIATQ GPVHETVYDF WRMIWQEQSA CIVMVTNLVE 120 VGRVKCYKYW PDDTEVYGDF KVTCVEMEPL AEYVVRTFTL ERRGYNEIRE VKQFHFTGWP 180 DHGVPYHATG LLSFIRRVKL SNPPSAGPIV VHCSAGAGRT GCYIVIDIML DMAEREGVVD 240 IYNCVKALRS RRINMVQTEE QYIFIHDAIL EACL 274 // ID hPTPkappa_D2\(NP_002835)\PTPRK STANDARD;PRT; 283 AA. AC NP_002835; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, K precursor; protein-tyrosine phosphatase, receptor type, kappa; protein-tyrosine phosphatase kappa; protein-tyrosine phosphatase kappa precursor [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from L77886.1 and BI755683.1. CC On Feb 22, 2002 this sequence version replaced gi:4506317. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem catalytic CC domains, and thus represents a receptor-type PTP. The extracellular CC region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like CC domain and four fibronectin type III-like repeats. This PTP was CC shown to mediate homophilic intercellular interaction, possibly CC through the interaction with beta- and gamma-catenin at adherens CC junctions. Expression of this gene was found to be stimulated by CC TGF-beta 1, which may be important for the inhibition of CC keratinocyte proliferation. CC GPRFLN|REFERENCE 1 (residues 1 to 1440) CC GPRFLN| AUTHORS Yang,Y., Gil,M.C., Choi,E.Y., Park,S.H., Pyun,K.H. and Ha,H. CC GPRFLN| TITLE Molecular cloning and chromosomal localization of a human gene CC GPRFLN| homologous to the murine R-PTP-kappa, a receptor-type protein CC GPRFLN| tyrosine phosphatase CC GPRFLN| JOURNAL Gene 186 (1), 77-82 (1997) CC GPRFLN| MEDLINE 97199372 CC GPRFLN|REFERENCE 2 (residues 1 to 1440) CC GPRFLN| AUTHORS Yang,Y., Gil,M., Byun,S.M., Choi,I., Pyun,K.H. and Ha,H. CC GPRFLN| TITLE Transforming growth factor-beta1 inhibits human keratinocyte CC GPRFLN| proliferation by upregulation of a receptor-type tyrosine CC GPRFLN| phosphatase R-PTP-kappa gene expression CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 228 (3), 807-812 (1996) CC GPRFLN| MEDLINE 97096334 CC GPRFLN|REFERENCE 3 (residues 1 to 1440) CC GPRFLN| AUTHORS Fuchs,M., Muller,T., Lerch,M.M. and Ullrich,A. CC GPRFLN| TITLE Association of human protein-tyrosine phosphatase kappa with CC GPRFLN| members of the armadillo family CC GPRFLN| JOURNAL J. Biol. Chem. 271 (28), 16712-16719 (1996) CC GPRFLN| MEDLINE 96279245 CC GPRFLN|REFERENCE 4 (residues 1 to 1440) CC GPRFLN| AUTHORS Zondag,G.C., Koningstein,G.M., Jiang,Y.P., Sap,J., Moolenaar,W.H. CC GPRFLN| and Gebbink,M.F. CC GPRFLN| TITLE Homophilic interactions mediated by receptor tyrosine phosphatases CC GPRFLN| mu and kappa. A critical role for the novel extracellular MAM CC GPRFLN| domain CC GPRFLN| JOURNAL J. Biol. Chem. 270 (24), 14247-14250 (1995) CC GPRFLN| MEDLINE 95301498 CC GPRFLN|REFERENCE 5 (residues 1 to 1440) CC GPRFLN| AUTHORS Sap,J., Jiang,Y.P., Friedlander,D., Grumet,M. and Schlessinger,J. CC GPRFLN| TITLE Receptor tyrosine phosphatase R-PTP-kappa mediates homophilic CC GPRFLN| binding CC GPRFLN| JOURNAL Mol. Cell. Biol. 14 (1), 1-9 (1994) CC GPRFLN| MEDLINE 94088505 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein-tyrosine phosphatase, receptor type, kappa; protein-tyrosine phosphatase kappa; protein-tyrosine phosphatase kappa precursor FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 19 283 PTPc FT VNTIFKEY:266; VNTINAME:Region_3 SQ SEQUENCE 283 AA; KAAYFDMIRI DSQTNSSHLK DEFQTLNSVT PRLQAEDCSI ACLPRNHDKN RFMDMLPPDR 60 CLPFLITIDG ESSNYINAAL MDSYRQPAAF IVTQYPLPNT VKDFWRLVYD YGCTSIVMLN 120 EVDLSQGCPQ YWPEEGMLRY GPIQVECMSC SMDCDVINRI FRICNLTRPQ EGYLMVQQFQ 180 YLGWASHREV PGSKRSFLKL ILQVEKWQEE CEEGEGRTII HCLNGGGRSG MFCAIGIVVE 240 MVKRQNVVDV FHAVKTLRNS KPNMVEAPEQ YRFCYDVALE YLE 283 // ID hPTPlamda_D1\(NP_005695)\PTPRU STANDARD;PRT; 270 AA. AC NP_005695; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, U isoform 3 precursor; protein tyrosine phosphatase J; protein tyrosine phosphatase receptor omicron [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X97198.1 and X95712.1. CC On Mar 26, 2002 this sequence version replaced gi:5032003. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem intracellular CC catalytic domains, and thus represents a receptor-type PTP. The CC extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, CC Ig-like and fibronectin type III-like repeats. This PTP was thought CC to play roles in cell-cell recognition and adhesion. Studies of the CC similar gene in mice suggested the role of this PTP in early neural CC development. The expression of this gene was reported to be CC regulated by phorbol myristate acetate (PMA) or calcium ionophore CC in Jurkat T lymphoma cells. Three alternatively spliced transcript CC variants, which encode distinct proteins, have been reported. CC CC Transcript Variant: This variant (3) encodes the longest isoform CC (3). CC GPRFLN|REFERENCE 1 (residues 1 to 1446) CC GPRFLN| AUTHORS Yan,H.X., He,Y.Q., Dong,H., Zhang,P., Zeng,J.Z., Cao,H.F., Wu,M.C. CC GPRFLN| and Wang,H.Y. CC GPRFLN| TITLE Physical and functional interaction between receptor-like protein CC GPRFLN| tyrosine phosphatase PCP-2 and beta-catenin CC GPRFLN| JOURNAL Biochemistry 41 (52), 15854-15860 (2002) CC GPRFLN| MEDLINE 22389441 CC GPRFLN| REMARK GeneRIF: Expressed in a cell density-dependent fashion, PCP-2 CC GPRFLN| interacts directly with its substrate beta-catenin, independent of CC GPRFLN| the tyrosine phosphorylation state of beta-catenin. CC GPRFLN|REFERENCE 2 (residues 1 to 1446) CC GPRFLN| AUTHORS Wang,B., Kishihara,K., Zhang,D., Sakamoto,T. and Nomoto,K. CC GPRFLN| TITLE Transcriptional regulation of a receptor protein tyrosine CC GPRFLN| phosphatase gene hPTP-J by PKC-mediated signaling pathways in CC GPRFLN| Jurkat and Molt-4 T lymphoma cells CC GPRFLN| JOURNAL Biochim. Biophys. Acta 1450 (3), 331-340 (1999) CC GPRFLN| MEDLINE 99326162 CC GPRFLN|REFERENCE 3 (residues 1 to 1446) CC GPRFLN| AUTHORS Avraham,S., London,R., Tulloch,G.A., Ellis,M., Fu,Y., Jiang,S., CC GPRFLN| White,R.A., Painter,C., Steinberger,A.A. and Avraham,H. CC GPRFLN| TITLE Characterization and chromosomal localization of PTPRO, a novel CC GPRFLN| receptor protein tyrosine phosphatase, expressed in hematopoietic CC GPRFLN| stem cells CC GPRFLN| JOURNAL Gene 204 (1-2), 5-16 (1997) CC GPRFLN| MEDLINE 98094249 CC GPRFLN|REFERENCE 4 (residues 1 to 1446) CC GPRFLN| AUTHORS Wang,B., Kishihara,K., Zhang,D., Hara,H. and Nomoto,K. CC GPRFLN| TITLE Molecular cloning and characterization of a novel human receptor CC GPRFLN| protein tyrosine phosphatase gene, hPTP-J: down-regulation of gene CC GPRFLN| expression by PMA and calcium ionophore in Jurkat T lymphoma cells CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 231 (1), 77-81 (1997) CC GPRFLN| MEDLINE 97223402 CC GPRFLN|REFERENCE 5 (residues 1 to 1446) CC GPRFLN| AUTHORS Crossland,S., Smith,P.D. and Crompton,M.R. CC GPRFLN| TITLE Molecular cloning and characterization of PTP pi, a novel CC GPRFLN| receptor-like protein-tyrosine phosphatase CC GPRFLN| JOURNAL Biochem. J. 319 (Pt 1), 249-254 (1996) CC GPRFLN| MEDLINE 97024447 CC GPRFLN|REFERENCE 6 (residues 1 to 1446) CC GPRFLN| AUTHORS Wang,H., Lian,Z., Lerch,M.M., Chen,Z., Xie,W. and Ullrich,A. CC GPRFLN| TITLE Characterization of PCP-2, a novel receptor protein tyrosine CC GPRFLN| phosphatase of the MAM domain family CC GPRFLN| JOURNAL Oncogene 12 (12), 2555-2562 (1996) CC GPRFLN| MEDLINE 96293401 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 270 VNTIFKEY:269 FT PROTEIN 1 270 protein tyrosine phosphatase J; protein tyrosine phosphatase receptor omicron FT VNTIFKEY:270 FT CHAIN 1 270 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 270 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 270 AA; ADLLQHINQM KTAEGYGFKQ EYESFFEGWD ATKKKDKVKG SRQEPMPAYD RHRVKLHPML 60 GDPNADYINA NYIDGYHRSN HFIATQGPKP EMVYDFWRMV WQEHCSSIVM ITKLVEVGRV 120 KCSRYWPEDS DTYGDIKIML VKTETLAEYV VRTFALERRG YSARHEVRQF HFTAWPEHGV 180 PYHATGLLAF IRRVKASTPP DAGPIVIHCS AGTGRTGCYI VLDVMLDMAE CEGVVDIYNC 240 VKTLCSRRVN MIQTEEQYIF IHDAILEACL 270 // ID hPTPlamda_D2\(NP_005695)\PTPRU STANDARD;PRT; 284 AA. AC NP_005695; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, U isoform 3 precursor; protein tyrosine phosphatase J; protein tyrosine phosphatase receptor omicron [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X97198.1 and X95712.1. CC On Mar 26, 2002 this sequence version replaced gi:5032003. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem intracellular CC catalytic domains, and thus represents a receptor-type PTP. The CC extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, CC Ig-like and fibronectin type III-like repeats. This PTP was thought CC to play roles in cell-cell recognition and adhesion. Studies of the CC similar gene in mice suggested the role of this PTP in early neural CC development. The expression of this gene was reported to be CC regulated by phorbol myristate acetate (PMA) or calcium ionophore CC in Jurkat T lymphoma cells. Three alternatively spliced transcript CC variants, which encode distinct proteins, have been reported. CC CC Transcript Variant: This variant (3) encodes the longest isoform CC (3). CC GPRFLN|REFERENCE 1 (residues 1 to 1446) CC GPRFLN| AUTHORS Yan,H.X., He,Y.Q., Dong,H., Zhang,P., Zeng,J.Z., Cao,H.F., Wu,M.C. CC GPRFLN| and Wang,H.Y. CC GPRFLN| TITLE Physical and functional interaction between receptor-like protein CC GPRFLN| tyrosine phosphatase PCP-2 and beta-catenin CC GPRFLN| JOURNAL Biochemistry 41 (52), 15854-15860 (2002) CC GPRFLN| MEDLINE 22389441 CC GPRFLN| REMARK GeneRIF: Expressed in a cell density-dependent fashion, PCP-2 CC GPRFLN| interacts directly with its substrate beta-catenin, independent of CC GPRFLN| the tyrosine phosphorylation state of beta-catenin. CC GPRFLN|REFERENCE 2 (residues 1 to 1446) CC GPRFLN| AUTHORS Wang,B., Kishihara,K., Zhang,D., Sakamoto,T. and Nomoto,K. CC GPRFLN| TITLE Transcriptional regulation of a receptor protein tyrosine CC GPRFLN| phosphatase gene hPTP-J by PKC-mediated signaling pathways in CC GPRFLN| Jurkat and Molt-4 T lymphoma cells CC GPRFLN| JOURNAL Biochim. Biophys. Acta 1450 (3), 331-340 (1999) CC GPRFLN| MEDLINE 99326162 CC GPRFLN|REFERENCE 3 (residues 1 to 1446) CC GPRFLN| AUTHORS Avraham,S., London,R., Tulloch,G.A., Ellis,M., Fu,Y., Jiang,S., CC GPRFLN| White,R.A., Painter,C., Steinberger,A.A. and Avraham,H. CC GPRFLN| TITLE Characterization and chromosomal localization of PTPRO, a novel CC GPRFLN| receptor protein tyrosine phosphatase, expressed in hematopoietic CC GPRFLN| stem cells CC GPRFLN| JOURNAL Gene 204 (1-2), 5-16 (1997) CC GPRFLN| MEDLINE 98094249 CC GPRFLN|REFERENCE 4 (residues 1 to 1446) CC GPRFLN| AUTHORS Wang,B., Kishihara,K., Zhang,D., Hara,H. and Nomoto,K. CC GPRFLN| TITLE Molecular cloning and characterization of a novel human receptor CC GPRFLN| protein tyrosine phosphatase gene, hPTP-J: down-regulation of gene CC GPRFLN| expression by PMA and calcium ionophore in Jurkat T lymphoma cells CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 231 (1), 77-81 (1997) CC GPRFLN| MEDLINE 97223402 CC GPRFLN|REFERENCE 5 (residues 1 to 1446) CC GPRFLN| AUTHORS Crossland,S., Smith,P.D. and Crompton,M.R. CC GPRFLN| TITLE Molecular cloning and characterization of PTP pi, a novel CC GPRFLN| receptor-like protein-tyrosine phosphatase CC GPRFLN| JOURNAL Biochem. J. 319 (Pt 1), 249-254 (1996) CC GPRFLN| MEDLINE 97024447 CC GPRFLN|REFERENCE 6 (residues 1 to 1446) CC GPRFLN| AUTHORS Wang,H., Lian,Z., Lerch,M.M., Chen,Z., Xie,W. and Ullrich,A. CC GPRFLN| TITLE Characterization of PCP-2, a novel receptor protein tyrosine CC GPRFLN| phosphatase of the MAM domain family CC GPRFLN| JOURNAL Oncogene 12 (12), 2555-2562 (1996) CC GPRFLN| MEDLINE 96293401 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 284 VNTIFKEY:269 FT PROTEIN 1 284 protein tyrosine phosphatase J; protein tyrosine phosphatase receptor omicron FT VNTIFKEY:270 FT CHAIN 1 284 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 18 284 PTPc FT VNTIFKEY:266; VNTINAME:Region_3 SQ SEQUENCE 284 AA; KATYKEMIRI DPQSNSSQLR EEFQTLNSVT PPLDVEECSI ALLPRNRDKN RSMDVLPPDR 60 CLPFLISTDG DSNNYINAAL TDSYTRSAAF IVTLHPLQST TPDFWRLVYD YGCTSIVMLN 120 QLNQSNSAWP CLQYWPEPGR QQYGLMEVEF MSGTADEDLV ARVFRVQNIS RLQEGHLLVR 180 HFQFLRWSAY RDTPDSKKAF LHLLAEVDKW QAESGDGRTI VHCLNGGGRS GTFCACATVL 240 EMIRCHNLVD VFFAAKTLRN YKPNMVETMD QYHFCYDVAL EYLE 284 // ID hPTPmu_D1\(NP_002836)\PTPRM STANDARD;PRT; 274 AA. AC NP_002836; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, M precursor; protein tyrosine phosphatase, receptor type, mu polypeptide; protein tyrosine phosphatase mu precursor [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X58288.1 and AA281524.1. CC On Feb 22, 2002 this sequence version replaced gi:4506319. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem catalytic CC domains, and thus represents a receptor-type PTP. The extracellular CC region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like CC domain and four fibronectin type III-like repeats. This PTP has CC been shown to mediate cell-cell aggregation through the interaction CC with another molecule of this PTP on an adjacent cell. This PTP can CC interact with scaffolding protein RACK1/GNB2L1, which may be CC necessary for the downstream signaling in response to cell-cell CC adhesion. CC GPRFLN|REFERENCE 1 (residues 1 to 1452) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1452) CC GPRFLN| AUTHORS Mourton,T., Hellberg,C.B., Burden-Gulley,S.M., Hinman,J., Rhee,A. CC GPRFLN| and Brady-Kalnay,S.M. CC GPRFLN| TITLE The PTPmu protein-tyrosine phosphatase binds and recruits the CC GPRFLN| scaffolding protein RACK1 to cell-cell contacts CC GPRFLN| JOURNAL J. Biol. Chem. 276 (18), 14896-14901 (2001) CC GPRFLN| MEDLINE 21226727 CC GPRFLN|REFERENCE 3 (residues 1 to 1452) CC GPRFLN| AUTHORS Feiken,E., van Etten,I., Gebbink,M.F., Moolenaar,W.H. and CC GPRFLN| Zondag,G.C. CC GPRFLN| TITLE Intramolecular interactions between the juxtamembrane domain and CC GPRFLN| phosphatase domains of receptor protein-tyrosine phosphatase CC GPRFLN| RPTPmu. Regulation of catalytic activity CC GPRFLN| JOURNAL J. Biol. Chem. 275 (20), 15350-15356 (2000) CC GPRFLN| MEDLINE 20270248 CC GPRFLN|REFERENCE 4 (residues 1 to 1452) CC GPRFLN| AUTHORS Brady-Kalnay,S.M. and Tonks,N.K. CC GPRFLN| TITLE Identification of the homophilic binding site of the receptor CC GPRFLN| protein tyrosine phosphatase PTP mu CC GPRFLN| JOURNAL J. Biol. Chem. 269 (45), 28472-28477 (1994) CC GPRFLN| MEDLINE 95050637 CC GPRFLN|REFERENCE 5 (residues 1 to 1452) CC GPRFLN| AUTHORS Suijkerbuijk,R.F., Gebbink,M.F., Moolenaar,W.H. and Geurts van CC GPRFLN| Kessel,A. CC GPRFLN| TITLE Fine mapping of the human receptor-like protein tyrosine CC GPRFLN| phosphatase gene (PTPRM) to 18p11.2 by fluorescence in situ CC GPRFLN| hybridization CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 64 (3-4), 245-246 (1993) CC GPRFLN| MEDLINE 94007972 CC GPRFLN|REFERENCE 6 (residues 1 to 1452) CC GPRFLN| AUTHORS Brady-Kalnay,S.M., Flint,A.J. and Tonks,N.K. CC GPRFLN| TITLE Homophilic binding of PTP mu, a receptor-type protein tyrosine CC GPRFLN| phosphatase, can mediate cell-cell aggregation CC GPRFLN| JOURNAL J. Cell Biol. 122 (4), 961-972 (1993) CC GPRFLN| MEDLINE 93352709 CC GPRFLN|REFERENCE 7 (residues 1 to 1452) CC GPRFLN| AUTHORS Gebbink,M.F., van Etten,I., Hateboer,G., Suijkerbuijk,R., CC GPRFLN| Beijersbergen,R.L., Geurts van Kessel,A. and Moolenaar,W.H. CC GPRFLN| TITLE Cloning, expression and chromosomal localization of a new putative CC GPRFLN| receptor-like protein tyrosine phosphatase CC GPRFLN| JOURNAL FEBS Lett. 290 (1-2), 123-130 (1991) CC GPRFLN| MEDLINE 92008644 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 274 VNTIFKEY:269 FT PROTEIN 1 274 protein tyrosine phosphatase, receptor type, mu polypeptide; protein tyrosine phosphatase mu precursor FT VNTIFKEY:270 FT CHAIN 1 274 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 274 AA; ADLLQHITQM KCAEGYGFKE EYESFFEGQS APWDSAKKDE NRMKNRYGNI IAYDHSRVRL 60 QTIEGDTNSD YINGNYIDGY HRPNHYIATQ GPMQETIYDF WRMVWHENTA SIIMVTNLVE 120 VGRVKCCKYW PDDTEIYKDI KVTLIETELL AEYVIRTFAV EKRGVHEIRE IRQFHFTGWP 180 DHGVPYHATG LLGFVRQVKS KSPPSAGPLV VHCSAGAGRT GCFIVIDIML DMAEREGVVD 240 IYNCVRELRS RRVNMVQTEE QYVFIHDAIL EACL 274 // ID hPTPmu_D2\(NP_002836)\PTPRM STANDARD;PRT; 283 AA. AC NP_002836; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, M precursor; protein tyrosine phosphatase, receptor type, mu polypeptide; protein tyrosine phosphatase mu precursor [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from X58288.1 and AA281524.1. CC On Feb 22, 2002 this sequence version replaced gi:4506319. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem catalytic CC domains, and thus represents a receptor-type PTP. The extracellular CC region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like CC domain and four fibronectin type III-like repeats. This PTP has CC been shown to mediate cell-cell aggregation through the interaction CC with another molecule of this PTP on an adjacent cell. This PTP can CC interact with scaffolding protein RACK1/GNB2L1, which may be CC necessary for the downstream signaling in response to cell-cell CC adhesion. CC GPRFLN|REFERENCE 1 (residues 1 to 1452) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1452) CC GPRFLN| AUTHORS Mourton,T., Hellberg,C.B., Burden-Gulley,S.M., Hinman,J., Rhee,A. CC GPRFLN| and Brady-Kalnay,S.M. CC GPRFLN| TITLE The PTPmu protein-tyrosine phosphatase binds and recruits the CC GPRFLN| scaffolding protein RACK1 to cell-cell contacts CC GPRFLN| JOURNAL J. Biol. Chem. 276 (18), 14896-14901 (2001) CC GPRFLN| MEDLINE 21226727 CC GPRFLN|REFERENCE 3 (residues 1 to 1452) CC GPRFLN| AUTHORS Feiken,E., van Etten,I., Gebbink,M.F., Moolenaar,W.H. and CC GPRFLN| Zondag,G.C. CC GPRFLN| TITLE Intramolecular interactions between the juxtamembrane domain and CC GPRFLN| phosphatase domains of receptor protein-tyrosine phosphatase CC GPRFLN| RPTPmu. Regulation of catalytic activity CC GPRFLN| JOURNAL J. Biol. Chem. 275 (20), 15350-15356 (2000) CC GPRFLN| MEDLINE 20270248 CC GPRFLN|REFERENCE 4 (residues 1 to 1452) CC GPRFLN| AUTHORS Brady-Kalnay,S.M. and Tonks,N.K. CC GPRFLN| TITLE Identification of the homophilic binding site of the receptor CC GPRFLN| protein tyrosine phosphatase PTP mu CC GPRFLN| JOURNAL J. Biol. Chem. 269 (45), 28472-28477 (1994) CC GPRFLN| MEDLINE 95050637 CC GPRFLN|REFERENCE 5 (residues 1 to 1452) CC GPRFLN| AUTHORS Suijkerbuijk,R.F., Gebbink,M.F., Moolenaar,W.H. and Geurts van CC GPRFLN| Kessel,A. CC GPRFLN| TITLE Fine mapping of the human receptor-like protein tyrosine CC GPRFLN| phosphatase gene (PTPRM) to 18p11.2 by fluorescence in situ CC GPRFLN| hybridization CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 64 (3-4), 245-246 (1993) CC GPRFLN| MEDLINE 94007972 CC GPRFLN|REFERENCE 6 (residues 1 to 1452) CC GPRFLN| AUTHORS Brady-Kalnay,S.M., Flint,A.J. and Tonks,N.K. CC GPRFLN| TITLE Homophilic binding of PTP mu, a receptor-type protein tyrosine CC GPRFLN| phosphatase, can mediate cell-cell aggregation CC GPRFLN| JOURNAL J. Cell Biol. 122 (4), 961-972 (1993) CC GPRFLN| MEDLINE 93352709 CC GPRFLN|REFERENCE 7 (residues 1 to 1452) CC GPRFLN| AUTHORS Gebbink,M.F., van Etten,I., Hateboer,G., Suijkerbuijk,R., CC GPRFLN| Beijersbergen,R.L., Geurts van Kessel,A. and Moolenaar,W.H. CC GPRFLN| TITLE Cloning, expression and chromosomal localization of a new putative CC GPRFLN| receptor-like protein tyrosine phosphatase CC GPRFLN| JOURNAL FEBS Lett. 290 (1-2), 123-130 (1991) CC GPRFLN| MEDLINE 92008644 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein tyrosine phosphatase, receptor type, mu polypeptide; protein tyrosine phosphatase mu precursor FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 18 282 PTPc FT VNTIFKEY:266; VNTINAME:Region_3 SQ SEQUENCE 283 AA; RSLYYDMNKL DPQTNSSQIK EEFRTLNMVT PTLRVEDCSI ALLPRNHEKN RCMDILPPDR 60 CLPFLITIDG ESSNYINAAL MDSYKQPSAF IVTQHPLPNT VKDFWRLVLD YHCTSVVMLN 120 DVDPAQLCPQ YWPENGVHRH GPIQVEFVSA DLEEDIISRI FRIYNAARPQ DGYRMVQQFQ 180 FLGWPMYRDT PVSKRSFLKL IRQVDKWQEE YNGGEGPTVV HCLNGGGRSG TFCAISIVCE 240 MLRHQRTVDV FHAVKTLRNN KPNMVDLLDQ YKFCYEVALE YLN 283 // ID hPTPrho_D1\(NP_573400)\PTPRT STANDARD;PRT; 274 AA. AC NP_573400; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, T isoform 1 precursor; receptor protein tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from AF043644.4 and R50970.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem intracellular CC catalytic domains, and thus represents a receptor-type PTP. The CC extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, CC Ig-like and fibronectin type III-like repeats. The protein domain CC structure and the expression pattern of the mouse counterpart of CC this PTP suggest its roles in both signal transduction and cellular CC adhesion in the central nervous system. Two alternatively spliced CC transcript variants of this gene, which encode distinct proteins, CC have been reported. CC CC Transcript Variant: This variant (1) contains an additional CC fragment within the coding region when compared to variant 2, and CC thus encodes a protein that contains an extra internal segment, as CC compared to isoform 2. CC GPRFLN|REFERENCE 1 (residues 1 to 1463) CC GPRFLN| AUTHORS Besco,J.A., Frostholm,A., Popesco,M.C., Burghes,A.H. and Rotter,A. CC GPRFLN| TITLE Genomic organization and alternative splicing of the human and CC GPRFLN| mouse RPTPrho genes CC GPRFLN| JOURNAL BMC Genomics 2 (1), 1 (2001) CC GPRFLN|REFERENCE 2 (residues 1 to 1463) CC GPRFLN| AUTHORS McAndrew,P.E., Frostholm,A., White,R.A., Rotter,A. and Burghes,A.H. CC GPRFLN| TITLE Identification and characterization of RPTP rho, a novel RPTP CC GPRFLN| mu/kappa-like receptor protein tyrosine phosphatase whose CC GPRFLN| expression is restricted to the central nervous system CC GPRFLN| JOURNAL Brain Res. Mol. Brain Res. 56 (1-2), 9-21 (1998) CC GPRFLN| MEDLINE 98267260 CC GPRFLN|REFERENCE 3 (residues 1 to 1463) CC GPRFLN| AUTHORS McAndrew,P.E., Frostholm,A., Evans,J.E., Zdilar,D., Goldowitz,D., CC GPRFLN| Chiu,I.M., Burghes,A.H. and Rotter,A. CC GPRFLN| TITLE Novel receptor protein tyrosine phosphatase (RPTPrho) and acidic CC GPRFLN| fibroblast growth factor (FGF-1) transcripts delineate a CC GPRFLN| rostrocaudal boundary in the granule cell layer of the murine CC GPRFLN| cerebellar cortex CC GPRFLN| JOURNAL J. Comp. Neurol. 391 (4), 444-455 (1998) CC GPRFLN| MEDLINE 98146229 CC GPRFLN|REFERENCE 4 (residues 1 to 1463) CC GPRFLN| AUTHORS Hillier,L.D., Lennon,G., Becker,M., Bonaldo,M.F., Chiapelli,B., CC GPRFLN| Chissoe,S., Dietrich,N., DuBuque,T., Favello,A., Gish,W., CC GPRFLN| Hawkins,M., Hultman,M., Kucaba,T., Lacy,M., Le,M., Le,N., CC GPRFLN| Mardis,E., Moore,B., Morris,M., Parsons,J., Prange,C., Rifkin,L., CC GPRFLN| Rohlfing,T., Schellenberg,K., Marra,M. et al. CC GPRFLN| TITLE Generation and analysis of 280,000 human expressed sequence tags CC GPRFLN| JOURNAL Genome Res. 6 (9), 807-828 (1996) CC GPRFLN| MEDLINE 97044478 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 274 VNTIFKEY:269 FT PROTEIN 1 274 receptor protein tyrosine phosphatase FT VNTIFKEY:270 FT CHAIN 1 274 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 274 AA; ADLLQHITQM KRGQGYGFKE EYEALPEGQT ASWDTAKEDE NRNKNRYGNI ISYDHSRVRL 60 LVLDGDPHSD YINANYIDGY HRPRHYIATQ GPMQETVKDF WRMIWQENSA SIVMVTNLVE 120 VGRVKCVRYW PDDTEVYGDI KVTLIETEPL AEYVIRTFTV QKKGYHEIRE LRLFHFTSWP 180 DHGVPCYATG LLGFVRQVKF LNPPEAGPIV VHCSAGAGRT GCFIAIDTML DMAENEGVVD 240 IFNCVRELRA QRVNLVQTEE QYVFVHDAIL EACL 274 // ID hPTPrho_D2\(NP_573400)\PTPRT STANDARD;PRT; 283 AA. AC NP_573400; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, T isoform 1 precursor; receptor protein tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from AF043644.4 and R50970.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and two tandem intracellular CC catalytic domains, and thus represents a receptor-type PTP. The CC extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, CC Ig-like and fibronectin type III-like repeats. The protein domain CC structure and the expression pattern of the mouse counterpart of CC this PTP suggest its roles in both signal transduction and cellular CC adhesion in the central nervous system. Two alternatively spliced CC transcript variants of this gene, which encode distinct proteins, CC have been reported. CC CC Transcript Variant: This variant (1) contains an additional CC fragment within the coding region when compared to variant 2, and CC thus encodes a protein that contains an extra internal segment, as CC compared to isoform 2. CC GPRFLN|REFERENCE 1 (residues 1 to 1463) CC GPRFLN| AUTHORS Besco,J.A., Frostholm,A., Popesco,M.C., Burghes,A.H. and Rotter,A. CC GPRFLN| TITLE Genomic organization and alternative splicing of the human and CC GPRFLN| mouse RPTPrho genes CC GPRFLN| JOURNAL BMC Genomics 2 (1), 1 (2001) CC GPRFLN|REFERENCE 2 (residues 1 to 1463) CC GPRFLN| AUTHORS McAndrew,P.E., Frostholm,A., White,R.A., Rotter,A. and Burghes,A.H. CC GPRFLN| TITLE Identification and characterization of RPTP rho, a novel RPTP CC GPRFLN| mu/kappa-like receptor protein tyrosine phosphatase whose CC GPRFLN| expression is restricted to the central nervous system CC GPRFLN| JOURNAL Brain Res. Mol. Brain Res. 56 (1-2), 9-21 (1998) CC GPRFLN| MEDLINE 98267260 CC GPRFLN|REFERENCE 3 (residues 1 to 1463) CC GPRFLN| AUTHORS McAndrew,P.E., Frostholm,A., Evans,J.E., Zdilar,D., Goldowitz,D., CC GPRFLN| Chiu,I.M., Burghes,A.H. and Rotter,A. CC GPRFLN| TITLE Novel receptor protein tyrosine phosphatase (RPTPrho) and acidic CC GPRFLN| fibroblast growth factor (FGF-1) transcripts delineate a CC GPRFLN| rostrocaudal boundary in the granule cell layer of the murine CC GPRFLN| cerebellar cortex CC GPRFLN| JOURNAL J. Comp. Neurol. 391 (4), 444-455 (1998) CC GPRFLN| MEDLINE 98146229 CC GPRFLN|REFERENCE 4 (residues 1 to 1463) CC GPRFLN| AUTHORS Hillier,L.D., Lennon,G., Becker,M., Bonaldo,M.F., Chiapelli,B., CC GPRFLN| Chissoe,S., Dietrich,N., DuBuque,T., Favello,A., Gish,W., CC GPRFLN| Hawkins,M., Hultman,M., Kucaba,T., Lacy,M., Le,M., Le,N., CC GPRFLN| Mardis,E., Moore,B., Morris,M., Parsons,J., Prange,C., Rifkin,L., CC GPRFLN| Rohlfing,T., Schellenberg,K., Marra,M. et al. CC GPRFLN| TITLE Generation and analysis of 280,000 human expressed sequence tags CC GPRFLN| JOURNAL Genome Res. 6 (9), 807-828 (1996) CC GPRFLN| MEDLINE 97044478 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 receptor protein tyrosine phosphatase FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 18 283 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 283 AA; RSLYYNISRL DPQTNSSQIK DEFQTLNIVT PRVRPEDCSI GLLPRNHDKN RSMDVLPLDR 60 CLPFLISVDG ESSNYINAAL MDSHKQPAAF VVTQHPLPNT VADFWRLVFD YNCSSVVMLN 120 EMDTAQFCMQ YWPEKTSGCY GPIQVEFVSA DIDEDIIHRI FRICNMARPQ DGYRIVQHLQ 180 YIGWPAYRDT PPSKRSLLKV VRRLEKWQEQ YDGREGRTVV HCLNGGGRSG TFCAICSVCE 240 MIQQQNIIDV FHIVKTLRNN KSNMVETLEQ YKFVYEVALE YLS 283 // ID hPTPS31_D1\(AR073855)\PTPGMC1 STANDARD;PRT; 276 AA. DT 17-MAY-2003 DE Translation of a fragment of delete. KW TRANSLATED. CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| SQ SEQUENCE 276 AA; KSFLQHVEEL CTNNNLKFQE EFSELPKFLQ DLSSTDADLP WNRAKNRFPN IKPYNNNRVK 60 LIADASVPGS DYINASYISG YLCPNEFIAT QGPLPGTVGD FWRMVWETRA KTLVMLTQCF 120 EKGRIRCHQY WPEDNKPVTV FGDIVITKLM EDVQIDWTIR DLKIERHGDC MTVRQCNFTA 180 WPEHGVPENS APLIHFVKLV RASRAHDTTP MIVHCSAGVG RTGVFIALDH LTQHINDHDF 240 VDIYGLVAEL RSERMCMVQN LAQYIFLHQC ILDLLS 276 // ID hPTPsigma_D1\(NP_002841)\PTPRS STANDARD;PRT; 275 AA. AC NP_002841; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, sigma isoform 1 precursor; protein tyrosine phosphatase PTPsigma [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from U35234.1 and BI461316.1. CC On Mar 26, 2002 this sequence version replaced gi:4506327. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC region, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. The extracellular region of this protein is CC composed of multiple Ig-like and fibronectin type III-like domains. CC Studies of the similar gene in mice suggested that this PTP may be CC involved in cell-cell interaction, primary axonogenesis, and axon CC guidance during embryogenesis. This PTP has been also implicated in CC the molecular control of adult nerve repair. Four alternatively CC spliced transcript variants, which encode distinct proteins, have CC been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1948) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1948) CC GPRFLN| AUTHORS Wallace,M.J., Batt,J., Fladd,C.A., Henderson,J.T., Skarnes,W. and CC GPRFLN| Rotin,D. CC GPRFLN| TITLE Neuronal defects and posterior pituitary hypoplasia in mice lacking CC GPRFLN| the receptor tyrosine phosphatase PTPsigma CC GPRFLN| JOURNAL Nat. Genet. 21 (3), 334-338 (1999) CC GPRFLN| MEDLINE 99178277 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 3 (residues 1 to 1948) CC GPRFLN| AUTHORS Elchebly,M., Wagner,J., Kennedy,T.E., Lanctot,C., Michaliszyn,E., CC GPRFLN| Itie,A., Drouin,J. and Tremblay,M.L. CC GPRFLN| TITLE Neuroendocrine dysplasia in mice lacking protein tyrosine CC GPRFLN| phosphatase sigma CC GPRFLN| JOURNAL Nat. Genet. 21 (3), 330-333 (1999) CC GPRFLN| MEDLINE 99178276 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 4 (residues 1 to 1948) CC GPRFLN| AUTHORS Haworth,K., Shu,K.K., Stokes,A., Morris,R. and Stoker,A. CC GPRFLN| TITLE The expression of receptor tyrosine phosphatases is responsive to CC GPRFLN| sciatic nerve crush CC GPRFLN| JOURNAL Mol. Cell. Neurosci. 12 (3), 93-104 (1998) CC GPRFLN| MEDLINE 99009170 CC GPRFLN| REMARK functional study of the rat homolog CC GPRFLN|REFERENCE 5 (residues 1 to 1948) CC GPRFLN| AUTHORS Wagner,J., Gordon,L.A., Heng,H.H., Tremblay,M.L. and Olsen,A.S. CC GPRFLN| TITLE Physical mapping of receptor type protein tyrosine phosphatase CC GPRFLN| sigma (PTPRS) to human chromosome 19p13.3 CC GPRFLN| JOURNAL Genomics 38 (1), 76-78 (1996) CC GPRFLN| MEDLINE 97124849 CC GPRFLN|REFERENCE 6 (residues 1 to 1948) CC GPRFLN| AUTHORS Endo,N., Rutledge,S.J., Opas,E.E., Vogel,R., Rodan,G.A. and CC GPRFLN| Schmidt,A. CC GPRFLN| TITLE Human protein tyrosine phosphatase-sigma: alternative splicing and CC GPRFLN| inhibition by bisphosphonates CC GPRFLN| JOURNAL J. Bone Miner. Res. 11 (4), 535-543 (1996) CC GPRFLN| MEDLINE 96255038 CC GPRFLN|REFERENCE 7 (residues 1 to 1948) CC GPRFLN| AUTHORS Pulido,R., Serra-Pages,C., Tang,M. and Streuli,M. CC GPRFLN| TITLE The LAR/PTP delta/PTP sigma subfamily of transmembrane CC GPRFLN| protein-tyrosine-phosphatases: multiple human LAR, PTP delta, and CC GPRFLN| PTP sigma isoforms are expressed in a tissue-specific manner and CC GPRFLN| associate with the LAR-interacting protein LIP.1 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (25), 11686-11690 (1995) CC GPRFLN| MEDLINE 96102179 CC GPRFLN|REFERENCE 8 (residues 1 to 1948) CC GPRFLN| AUTHORS Adachi,M., Sekiya,M., Arimura,Y., Takekawa,M., Itoh,F., Hinoda,Y., CC GPRFLN| Imai,K. and Yachi,A. CC GPRFLN| TITLE Protein-tyrosine phosphatase expression in pre-B cell NALM-6 CC GPRFLN| JOURNAL Cancer Res. 52 (3), 737-740 (1992) CC GPRFLN| MEDLINE 92119637 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 protein tyrosine phosphatase PTPsigma FT VNTIFKEY:270 FT CHAIN 1 275 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_4 SQ SEQUENCE 275 AA; ADMAEHTERL KANDSLKLSQ EYESIDPGQQ FTWEHSNLEV NKPKNRYANV IAYDHSRVIL 60 QPIEGIMGSD YINANYVDGY RRQNAYIATQ GPLPETFGDF WRMVWEQRSA TIVMMTRLEE 120 KSRIKCDQYW PNRGTETYGF IQVTLLDTIE LATFCVRTFS LHKNGSSEKR EVRQFQFTAW 180 PDHGVPEYPT PFLAFLRRVK TCNPPDAGPI VVHCSAGVGR TGCFIVIDAM LERIKPEKTV 240 DVYGHVTLMR SQRNYMVQTE DQYSFIHEAL LEAVG 275 // ID hPTPsigma_D2\(NP_002841)\PTPRS STANDARD;PRT; 283 AA. AC NP_002841; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, sigma isoform 1 precursor; protein tyrosine phosphatase PTPsigma [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from U35234.1 and BI461316.1. CC On Mar 26, 2002 this sequence version replaced gi:4506327. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains an extracellular CC region, a single transmembrane segment and two tandem CC intracytoplasmic catalytic domains, and thus represents a CC receptor-type PTP. The extracellular region of this protein is CC composed of multiple Ig-like and fibronectin type III-like domains. CC Studies of the similar gene in mice suggested that this PTP may be CC involved in cell-cell interaction, primary axonogenesis, and axon CC guidance during embryogenesis. This PTP has been also implicated in CC the molecular control of adult nerve repair. Four alternatively CC spliced transcript variants, which encode distinct proteins, have CC been reported. CC CC Transcript Variant: This variant (1) encodes the longest isoform CC (1). CC GPRFLN|REFERENCE 1 (residues 1 to 1948) CC GPRFLN| AUTHORS Blanchetot,C., Tertoolen,L.G., Overvoorde,J. and den Hertog,J. CC GPRFLN| TITLE Intra- and intermolecular interactions between intracellular CC GPRFLN| domains of receptor protein-tyrosine phosphatases CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47263-47269 (2002) CC GPRFLN| MEDLINE 22344739 CC GPRFLN| REMARK GeneRIF: interactions between RPTP-domain1s and RPTP-domain 2s are CC GPRFLN| a common but specific mechanism that is likely to be regulated- CC GPRFLN| domain2s and the wedge structures are crucial determinants of CC GPRFLN| binding specificity, thus regulating cross-talk between RPTPs CC GPRFLN|REFERENCE 2 (residues 1 to 1948) CC GPRFLN| AUTHORS Wallace,M.J., Batt,J., Fladd,C.A., Henderson,J.T., Skarnes,W. and CC GPRFLN| Rotin,D. CC GPRFLN| TITLE Neuronal defects and posterior pituitary hypoplasia in mice lacking CC GPRFLN| the receptor tyrosine phosphatase PTPsigma CC GPRFLN| JOURNAL Nat. Genet. 21 (3), 334-338 (1999) CC GPRFLN| MEDLINE 99178277 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 3 (residues 1 to 1948) CC GPRFLN| AUTHORS Elchebly,M., Wagner,J., Kennedy,T.E., Lanctot,C., Michaliszyn,E., CC GPRFLN| Itie,A., Drouin,J. and Tremblay,M.L. CC GPRFLN| TITLE Neuroendocrine dysplasia in mice lacking protein tyrosine CC GPRFLN| phosphatase sigma CC GPRFLN| JOURNAL Nat. Genet. 21 (3), 330-333 (1999) CC GPRFLN| MEDLINE 99178276 CC GPRFLN| REMARK functional study of the mouse homolog CC GPRFLN|REFERENCE 4 (residues 1 to 1948) CC GPRFLN| AUTHORS Haworth,K., Shu,K.K., Stokes,A., Morris,R. and Stoker,A. CC GPRFLN| TITLE The expression of receptor tyrosine phosphatases is responsive to CC GPRFLN| sciatic nerve crush CC GPRFLN| JOURNAL Mol. Cell. Neurosci. 12 (3), 93-104 (1998) CC GPRFLN| MEDLINE 99009170 CC GPRFLN| REMARK functional study of the rat homolog CC GPRFLN|REFERENCE 5 (residues 1 to 1948) CC GPRFLN| AUTHORS Wagner,J., Gordon,L.A., Heng,H.H., Tremblay,M.L. and Olsen,A.S. CC GPRFLN| TITLE Physical mapping of receptor type protein tyrosine phosphatase CC GPRFLN| sigma (PTPRS) to human chromosome 19p13.3 CC GPRFLN| JOURNAL Genomics 38 (1), 76-78 (1996) CC GPRFLN| MEDLINE 97124849 CC GPRFLN|REFERENCE 6 (residues 1 to 1948) CC GPRFLN| AUTHORS Endo,N., Rutledge,S.J., Opas,E.E., Vogel,R., Rodan,G.A. and CC GPRFLN| Schmidt,A. CC GPRFLN| TITLE Human protein tyrosine phosphatase-sigma: alternative splicing and CC GPRFLN| inhibition by bisphosphonates CC GPRFLN| JOURNAL J. Bone Miner. Res. 11 (4), 535-543 (1996) CC GPRFLN| MEDLINE 96255038 CC GPRFLN|REFERENCE 7 (residues 1 to 1948) CC GPRFLN| AUTHORS Pulido,R., Serra-Pages,C., Tang,M. and Streuli,M. CC GPRFLN| TITLE The LAR/PTP delta/PTP sigma subfamily of transmembrane CC GPRFLN| protein-tyrosine-phosphatases: multiple human LAR, PTP delta, and CC GPRFLN| PTP sigma isoforms are expressed in a tissue-specific manner and CC GPRFLN| associate with the LAR-interacting protein LIP.1 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (25), 11686-11690 (1995) CC GPRFLN| MEDLINE 96102179 CC GPRFLN|REFERENCE 8 (residues 1 to 1948) CC GPRFLN| AUTHORS Adachi,M., Sekiya,M., Arimura,Y., Takekawa,M., Itoh,F., Hinoda,Y., CC GPRFLN| Imai,K. and Yachi,A. CC GPRFLN| TITLE Protein-tyrosine phosphatase expression in pre-B cell NALM-6 CC GPRFLN| JOURNAL Cancer Res. 52 (3), 737-740 (1992) CC GPRFLN| MEDLINE 92119637 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein tyrosine phosphatase PTPsigma FT VNTIFKEY:270 FT CHAIN 1 283 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 21 282 PTPc FT VNTIFKEY:266; VNTINAME:Region_5 SQ SEQUENCE 283 AA; RSLYAYIQKL AQVEPGEHVT GMELEFKRLA NSKAHTSRFI SANLPCNKFK NRLVNIMPYE 60 STRVCLQPIR GVEGSDYINA SFIDGYRQQK AYIATQGPLA ETTEDFWRML WENNSTIVVM 120 LTKLREMGRE KCHQYWPAER SARYQYFVVD PMAEYNMPQY ILREFKVTDA RDGQSRTVRQ 180 FQFTDWPEQG VPKSGEGFID FIGQVHKTKE QFGQDGPISV HCSAGVGRTG VFITLSIVLE 240 RMRYEGVVDI FQTVKMLRTQ RPAMVQTEDE YQFCYQAALE YLG 283 // ID hPTPTyp_D1\(AL050040)\PTPN20 STANDARD;PRT; 274 AA. DT 17-MAY-2003 DE Translation of a fragment of hPTPTyp (AL050040). KW TRANSLATED. CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| SQ SEQUENCE 274 AA; TAIKDCLKIL EEKTAAYDIM QEFMALELKN LPGEFYSGNQ PSNREKNRYR DILPYDSTRV 60 PLGKSKDYIN ASYIRIVNCG EEYFYIATQG PLLSTIDDFW QMVLENNSNV IAMITREMEG 120 GIIKCYHYWP ISLKKPLELK HFRVFLENYQ ILQYFIIRMF QVVEKSTGTS HSVKQLQFTK 180 WPDHGTPASA DSFIKYIRYA RKSHLTGPMV VHCSAGIGRT GVFLCVDVVF CAIVKDCSFN 240 IMDIVAQMRE QRSGMVQTKE QYHFCYDIVL EVLR 274 // ID hPTPzeta_D1\(NP_002842)\PTPRZ1 STANDARD;PRT; 293 AA. AC NP_002842; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor-type, Z polypeptide 1; protein tyrosine phosphatase, receptor-type, zeta polypeptide 1; receptor-type tyrosine phosphatase beta/zeta [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from M93426.1. CC GPRFLN|REFERENCE 1 (residues 1 to 2314) CC GPRFLN| AUTHORS Harroch,S., Furtado,G.C., Brueck,W., Rosenbluth,J., Lafaille,J., CC GPRFLN| Chao,M., Buxbaum,J.D. and Schlessinger,J. CC GPRFLN| TITLE A critical role for the protein tyrosine phosphatase receptor type CC GPRFLN| Z in functional recovery from demyelinating lesions CC GPRFLN| JOURNAL Nat. Genet. 32 (3), 411-414 (2002) CC GPRFLN| MEDLINE 22297719 CC GPRFLN| REMARK GeneRIF: PTPRZ1 has a role in oligodendrocyte survival and in CC GPRFLN| recovery from demyelinating disease CC GPRFLN|REFERENCE 2 (residues 1 to 2314) CC GPRFLN| AUTHORS Thomaidou,D., Coquillat,D., Meintanis,S., Noda,M., Rougon,G. and CC GPRFLN| Matsas,R. CC GPRFLN| TITLE Soluble forms of NCAM and F3 neuronal cell adhesion molecules CC GPRFLN| promote Schwann cell migration: identification of protein tyrosine CC GPRFLN| phosphatases zeta/beta as the putative F3 receptors on Schwann CC GPRFLN| cells CC GPRFLN| JOURNAL J. Neurochem. 78 (4), 767-778 (2001) CC GPRFLN| MEDLINE 21412137 CC GPRFLN|REFERENCE 3 (residues 1 to 2314) CC GPRFLN| AUTHORS Kawachi,H., Fujikawa,A., Maeda,N. and Noda,M. CC GPRFLN| TITLE Identification of GIT1/Cat-1 as a substrate molecule of protein CC GPRFLN| tyrosine phosphatase zeta /beta by the yeast substrate-trapping CC GPRFLN| system CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 98 (12), 6593-6598 (2001) CC GPRFLN| MEDLINE 21287250 CC GPRFLN|REFERENCE 4 (residues 1 to 2314) CC GPRFLN| AUTHORS Meng,K., Rodriguez-Pena,A., Dimitrov,T., Chen,W., Yamin,M., Noda,M. CC GPRFLN| and Deuel,T.F. CC GPRFLN| TITLE Pleiotrophin signals increased tyrosine phosphorylation of beta CC GPRFLN| beta-catenin through inactivation of the intrinsic catalytic CC GPRFLN| activity of the receptor-type protein tyrosine phosphatase CC GPRFLN| beta/zeta CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (6), 2603-2608 (2000) CC GPRFLN| MEDLINE 20183934 CC GPRFLN|REFERENCE 5 (residues 1 to 2314) CC GPRFLN| AUTHORS Kawachi,H., Tamura,H., Watakabe,I., Shintani,T., Maeda,N. and CC GPRFLN| Noda,M. CC GPRFLN| TITLE Protein tyrosine phosphatase zeta/RPTPbeta interacts with CC GPRFLN| PSD-95/SAP90 family CC GPRFLN| JOURNAL Brain Res. Mol. Brain Res. 72 (1), 47-54 (1999) CC GPRFLN| MEDLINE 99453345 CC GPRFLN|REFERENCE 6 (residues 1 to 2314) CC GPRFLN| AUTHORS Onyango,P., Lubyova,B., Gardellin,P., Kurzbauer,R. and Weith,A. CC GPRFLN| TITLE Molecular cloning and expression analysis of five novel genes in CC GPRFLN| chromosome 1p36 CC GPRFLN| JOURNAL Genomics 50 (2), 187-198 (1998) CC GPRFLN| MEDLINE 98317532 CC GPRFLN|REFERENCE 7 (residues 1 to 2314) CC GPRFLN| AUTHORS Ariyama,T., Hasegawa,K., Inazawa,J., Mizuno,K., Ogimoto,M., CC GPRFLN| Katagiri,T. and Yakura,H. CC GPRFLN| TITLE Assignment of the human protein tyrosine phosphatase, CC GPRFLN| receptor-type, zeta (PTPRZ) gene to chromosome band 7q31.3 CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 70 (1-2), 52-54 (1995) CC GPRFLN| MEDLINE 95254878 CC GPRFLN|REFERENCE 8 (residues 1 to 2314) CC GPRFLN| AUTHORS Levy,J.B., Canoll,P.D., Silvennoinen,O., Barnea,G., Morse,B., CC GPRFLN| Honegger,A.M., Huang,J.T., Cannizzaro,L.A., Park,S.H., Druck,T. et CC GPRFLN| al. CC GPRFLN| TITLE The cloning of a receptor-type protein tyrosine phosphatase CC GPRFLN| expressed in the central nervous system CC GPRFLN| JOURNAL J. Biol. Chem. 268 (14), 10573-10581 (1993) CC GPRFLN| MEDLINE 93252948 CC GPRFLN|REFERENCE 9 (residues 1 to 2314) CC GPRFLN| AUTHORS Krueger,N.X. and Saito,H. CC GPRFLN| TITLE A human transmembrane protein-tyrosine-phosphatase, PTP zeta, is CC GPRFLN| expressed in brain and has an N-terminal receptor domain homologous CC GPRFLN| to carbonic anhydrases CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (16), 7417-7421 (1992) CC GPRFLN| MEDLINE 92366472 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 293 VNTIFKEY:269 FT PROTEIN 1 293 protein tyrosine phosphatase, receptor-type, zeta polypeptide 1; receptor-type tyrosine phosphatase beta/zeta FT VNTIFKEY:270 FT REGION 15 293 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 293 AA; KHFPKHVADL HASSGFTEEF ETLKEFYQEV QSCTVDLGIT ADSSNHPDNK HKNRYINIVA 60 YDHSRVKLAQ LAEKDGKLTD YINANYVDGY NRPKAYIAAQ GPLKSTAEDF WRMIWEHNVE 120 VIVMITNLVE KGRRKCDQYW PADGSEEYGN FLVTQKSVQV LAYYTVRNFT LRNTKIKKGS 180 QKGRPSGRVV TQYHYTQWPD MGVPEYSLPV LTFVRKAAYA KRHAVGPVVV HCSAGVGRTG 240 TYIVLDSMLQ QIQHEGTVNI FGFLKHIRSQ RNYLVQTEEQ YVFIHDTLVE AIL 293 // ID hPTPzeta_D2\(NP_002842)\PTPRZ1 STANDARD;PRT; 282 AA. AC NP_002842; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor-type, Z polypeptide 1; protein tyrosine phosphatase, receptor-type, zeta polypeptide 1; receptor-type tyrosine phosphatase beta/zeta [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from M93426.1. CC GPRFLN|REFERENCE 1 (residues 1 to 2314) CC GPRFLN| AUTHORS Harroch,S., Furtado,G.C., Brueck,W., Rosenbluth,J., Lafaille,J., CC GPRFLN| Chao,M., Buxbaum,J.D. and Schlessinger,J. CC GPRFLN| TITLE A critical role for the protein tyrosine phosphatase receptor type CC GPRFLN| Z in functional recovery from demyelinating lesions CC GPRFLN| JOURNAL Nat. Genet. 32 (3), 411-414 (2002) CC GPRFLN| MEDLINE 22297719 CC GPRFLN| REMARK GeneRIF: PTPRZ1 has a role in oligodendrocyte survival and in CC GPRFLN| recovery from demyelinating disease CC GPRFLN|REFERENCE 2 (residues 1 to 2314) CC GPRFLN| AUTHORS Thomaidou,D., Coquillat,D., Meintanis,S., Noda,M., Rougon,G. and CC GPRFLN| Matsas,R. CC GPRFLN| TITLE Soluble forms of NCAM and F3 neuronal cell adhesion molecules CC GPRFLN| promote Schwann cell migration: identification of protein tyrosine CC GPRFLN| phosphatases zeta/beta as the putative F3 receptors on Schwann CC GPRFLN| cells CC GPRFLN| JOURNAL J. Neurochem. 78 (4), 767-778 (2001) CC GPRFLN| MEDLINE 21412137 CC GPRFLN|REFERENCE 3 (residues 1 to 2314) CC GPRFLN| AUTHORS Kawachi,H., Fujikawa,A., Maeda,N. and Noda,M. CC GPRFLN| TITLE Identification of GIT1/Cat-1 as a substrate molecule of protein CC GPRFLN| tyrosine phosphatase zeta /beta by the yeast substrate-trapping CC GPRFLN| system CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 98 (12), 6593-6598 (2001) CC GPRFLN| MEDLINE 21287250 CC GPRFLN|REFERENCE 4 (residues 1 to 2314) CC GPRFLN| AUTHORS Meng,K., Rodriguez-Pena,A., Dimitrov,T., Chen,W., Yamin,M., Noda,M. CC GPRFLN| and Deuel,T.F. CC GPRFLN| TITLE Pleiotrophin signals increased tyrosine phosphorylation of beta CC GPRFLN| beta-catenin through inactivation of the intrinsic catalytic CC GPRFLN| activity of the receptor-type protein tyrosine phosphatase CC GPRFLN| beta/zeta CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (6), 2603-2608 (2000) CC GPRFLN| MEDLINE 20183934 CC GPRFLN|REFERENCE 5 (residues 1 to 2314) CC GPRFLN| AUTHORS Kawachi,H., Tamura,H., Watakabe,I., Shintani,T., Maeda,N. and CC GPRFLN| Noda,M. CC GPRFLN| TITLE Protein tyrosine phosphatase zeta/RPTPbeta interacts with CC GPRFLN| PSD-95/SAP90 family CC GPRFLN| JOURNAL Brain Res. Mol. Brain Res. 72 (1), 47-54 (1999) CC GPRFLN| MEDLINE 99453345 CC GPRFLN|REFERENCE 6 (residues 1 to 2314) CC GPRFLN| AUTHORS Onyango,P., Lubyova,B., Gardellin,P., Kurzbauer,R. and Weith,A. CC GPRFLN| TITLE Molecular cloning and expression analysis of five novel genes in CC GPRFLN| chromosome 1p36 CC GPRFLN| JOURNAL Genomics 50 (2), 187-198 (1998) CC GPRFLN| MEDLINE 98317532 CC GPRFLN|REFERENCE 7 (residues 1 to 2314) CC GPRFLN| AUTHORS Ariyama,T., Hasegawa,K., Inazawa,J., Mizuno,K., Ogimoto,M., CC GPRFLN| Katagiri,T. and Yakura,H. CC GPRFLN| TITLE Assignment of the human protein tyrosine phosphatase, CC GPRFLN| receptor-type, zeta (PTPRZ) gene to chromosome band 7q31.3 CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 70 (1-2), 52-54 (1995) CC GPRFLN| MEDLINE 95254878 CC GPRFLN|REFERENCE 8 (residues 1 to 2314) CC GPRFLN| AUTHORS Levy,J.B., Canoll,P.D., Silvennoinen,O., Barnea,G., Morse,B., CC GPRFLN| Honegger,A.M., Huang,J.T., Cannizzaro,L.A., Park,S.H., Druck,T. et CC GPRFLN| al. CC GPRFLN| TITLE The cloning of a receptor-type protein tyrosine phosphatase CC GPRFLN| expressed in the central nervous system CC GPRFLN| JOURNAL J. Biol. Chem. 268 (14), 10573-10581 (1993) CC GPRFLN| MEDLINE 93252948 CC GPRFLN|REFERENCE 9 (residues 1 to 2314) CC GPRFLN| AUTHORS Krueger,N.X. and Saito,H. CC GPRFLN| TITLE A human transmembrane protein-tyrosine-phosphatase, PTP zeta, is CC GPRFLN| expressed in brain and has an N-terminal receptor domain homologous CC GPRFLN| to carbonic anhydrases CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (16), 7417-7421 (1992) CC GPRFLN| MEDLINE 92366472 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 282 VNTIFKEY:269 FT PROTEIN 1 282 protein tyrosine phosphatase, receptor-type, zeta polypeptide 1; receptor-type tyrosine phosphatase beta/zeta FT VNTIFKEY:270 FT REGION 20 282 PTPc FT VNTIFKEY:266; VNTINAME:Region_3 SQ SEQUENCE 282 AA; SHIHAYVNAL LIPGPAGKTK LEKQFQLLSQ SNIQQSDYSA ALKQCNREKN RTSSIIPVER 60 SRVGISSLSG EGTDYINASY IMGYYQSNEF IITQHPLLHT IKDFWRMIWD HNAQLVVMIP 120 DGQNMAEDEF VYWPNKDEPI NCESFKVTLM AEEHKCLSNE EKLIIQDFIL EATQDDYVLE 180 VRHFQCPKWP NPDSPISKTF ELISVIKEEA ANRDGPMIVH DEHGGVTAGT FCALTTLMHQ 240 LEKENSVDVY QVAKMINLMR PGVFADIEQY QFLYKVILSL VS 282 // ID hSAP1_D1\(NP_002833)\PTPRH STANDARD;PRT; 279 AA. AC NP_002833; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, H precursor [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from D15049.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP possesses an extracellular CC region, a single transmembrane region, and a single CC intracytoplasmic catalytic domain, and thus represents a CC receptor-type PTP. The extracellular region contains eight CC fibronectin type III-like repeats and multiple N-glycosylation CC sites. The gene was shown to be expressed primarily in brain and CC liver, and at a lower level in heart and stomach. It was also found CC to be expressed in several cancer cell lines, but not in the CC corresponding normal tissues. CC GPRFLN|REFERENCE 1 (residues 1 to 1118) CC GPRFLN| AUTHORS Takada,T., Noguchi,T., Inagaki,K., Hosooka,T., Fukunaga,K., CC GPRFLN| Yamao,T., Ogawa,W., Matozaki,T. and Kasuga,M. CC GPRFLN| TITLE Induction of apoptosis by stomach cancer-associated CC GPRFLN| protein-tyrosine phosphatase-1 CC GPRFLN| JOURNAL J. Biol. Chem. 277 (37), 34359-34366 (2002) CC GPRFLN| MEDLINE 22206505 CC GPRFLN| REMARK GeneRIF: SAP-1 induces apoptotic cell death by inhibition of cell CC GPRFLN| survival signaling mediated by PI 3-kinase, Akt, and ILK and CC GPRFLN| activation of a caspase-dependent proapoptotic pathway. CC GPRFLN|REFERENCE 2 (residues 1 to 1118) CC GPRFLN| AUTHORS Marneros,A.G., Mehenni,H., Reichenberger,E., Antonarakis,S.E., CC GPRFLN| Krieg,T. and Olsen,B.R. CC GPRFLN| TITLE Gene for the human transmembrane-type protein tyrosine phosphatase CC GPRFLN| H (PTPRH): genomic structure, fine-mapping and its exclusion as a CC GPRFLN| candidate for Peutz-Jeghers syndrome CC GPRFLN| JOURNAL Cytogenet. Cell Genet. 92 (3-4), 213-216 (2001) CC GPRFLN| MEDLINE 21328879 CC GPRFLN|REFERENCE 3 (residues 1 to 1118) CC GPRFLN| AUTHORS Matozaki,T., Suzuki,T., Uchida,T., Inazawa,J., Ariyama,T., CC GPRFLN| Matsuda,K., Horita,K., Noguchi,H., Mizuno,H., Sakamoto,C. et al. CC GPRFLN| TITLE Molecular cloning of a human transmembrane-type protein tyrosine CC GPRFLN| phosphatase and its expression in gastrointestinal cancers CC GPRFLN| JOURNAL J. Biol. Chem. 269 (3), 2075-2081 (1994) CC GPRFLN| MEDLINE 94124561 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT CHAIN 1 279 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 17 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; EDFADHVRKN ERDSNCGFAD EYQQLSLVGH SQSQMVASAS ENNAKNRYRN VLPYDWSRVP 60 LKPIHEEPGS DYINASFMPG LWSPQEFIAT QGPLPQTVGD FWRLVWEQQS HTLVMLTNCM 120 EAGRVKCEHY WPLDSQPCTH GHLRVTLVGE EVMENWTVRE LLLLQVEEQK TLSVRQFHYQ 180 AWPDHGVPSS PDTLLAFWRM LRQWLDQTME GGPPIVHCSA GVGRTGTLIA LDVLLRQLQS 240 EGLLGPFSFV RKMRESRPLM VQTEAQYVFL HQCICGSSN 279 // ID hSHP1_D1\(NP_002822)\PTPN6 STANDARD;PRT; 297 AA. AC NP_002822; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 6 isoform 1; protein-tyrosine phosphatase 1C; hematopoietic cell phophatase; hematopoietic cell protein-tyrosine phosphatase; 70 kda SHP-1L protein [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M77273.1, BC002523.1 and CC U15536.1. CC On Jan 10, 2002 this sequence version replaced gi:4506297. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. N-terminal part of this PTP contains two CC tandem Src homolog (SH2) domains, which act as protein CC phospho-tyrosine binding domains, and mediate the interaction of CC this PTP with its substrates. This PTP is expressed primarily in CC hematopoietic cells, and functions as an important regulator of CC multiple signaling pathways in hematopoietic cells. This PTP has CC been shown to interact with, and dephosphorylate a wide spectrum of CC phospho-proteins involved in hematopoietic cell signaling. Three CC alternatively spliced variants of this gene, which encode distinct CC isoforms, have been reported. CC CC Transcript Variant: This variant (1) lacks an internal fragment CC within the coding region, which leads to a translation frame change CC when compared to variant 3. It encodes a protein that has an CC identical N-terminus and a different C-terminus, as compared to CC isoform 3. CC GPRFLN|REFERENCE 1 (residues 1 to 595) CC GPRFLN| AUTHORS Hanson,E.M., Dickensheets,H., Qu,C.K., Donnelly,R.P. and CC GPRFLN| Keegan,A.D. CC GPRFLN| TITLE Regulation of the dephosphorylation of Stat6. Participation of CC GPRFLN| Tyr-713 in the interleukin-4 receptor alpha, the tyrosine CC GPRFLN| phosphatase SHP-1, and the proteasome CC GPRFLN| JOURNAL J. Biol. Chem. 278 (6), 3903-3911 (2003) CC GPRFLN| MEDLINE 22450671 CC GPRFLN| REMARK GeneRIF: participation in regulation of Stat6 dephosphorylation CC GPRFLN|REFERENCE 2 (residues 1 to 595) CC GPRFLN| AUTHORS Oka,T., Ouchida,M., Koyama,M., Ogama,Y., Takada,S., Nakatani,Y., CC GPRFLN| Tanaka,T., Yoshino,T., Hayashi,K., Ohara,N., Kondo,E., CC GPRFLN| Takahashi,K., Tsuchiyama,J., Tanimoto,M., Shimizu,K. and Akagi,T. CC GPRFLN| TITLE Gene silencing of the tyrosine phosphatase SHP1 gene by aberrant CC GPRFLN| methylation in leukemias/lymphomas CC GPRFLN| JOURNAL Cancer Res. 62 (22), 6390-6394 (2002) CC GPRFLN| MEDLINE 22325693 CC GPRFLN| REMARK GeneRIF: Functional loss of SHP1 is associated with the CC GPRFLN| pathogenesis of leukemias/lymphomas. CC GPRFLN|REFERENCE 3 (residues 1 to 595) CC GPRFLN| AUTHORS Leon,F., Cespon,C., Franco,A., Lombardia,M., Roldan,E., CC GPRFLN| Escribano,L., Harto,A., Gonzalez-Porque,P. and Roy,G. CC GPRFLN| TITLE SHP-1 expression in peripheral T cells from patients with Sezary CC GPRFLN| syndrome and in the T cell line HUT-78: implications in CC GPRFLN| JAK3-mediated signaling CC GPRFLN| JOURNAL Leukemia 16 (8), 1470-1477 (2002) CC GPRFLN| MEDLINE 22140504 CC GPRFLN| REMARK GeneRIF: In the T cell line HUT-78, JAK3 was found to be highly CC GPRFLN| phosphorylated. These results suggest that SHP-1 might be involved CC GPRFLN| in maintaining the IL-2R/JAK3 signaling pathway under control and CC GPRFLN| point towards a role of SHP-1 in the pathogenesis of the disease. CC GPRFLN|REFERENCE 4 (residues 1 to 595) CC GPRFLN| AUTHORS Nikolova,M., Musette,P., Bagot,M., Boumsell,L. and Bensussan,A. CC GPRFLN| TITLE Engagement of ILT2/CD85j in Sezary syndrome cells inhibits their CC GPRFLN| CD3/TCR signaling CC GPRFLN| JOURNAL Blood 100 (3), 1019-1025 (2002) CC GPRFLN| MEDLINE 22122461 CC GPRFLN| REMARK GeneRIF: ILT2 triggering on cutaneous T-cell lymphoma (CTCL) cells CC GPRFLN| leads to the recruitment of SHP-1 and to the specific inhibition of CC GPRFLN| CTCL malignant cell proliferation in S##zary syndrome induced by CC GPRFLN| CD3/T-cell receptor. (TCR) stimulation. CC GPRFLN|REFERENCE 5 (residues 1 to 595) CC GPRFLN| AUTHORS Angata,T., Kerr,S.C., Greaves,D.R., Varki,N.M., Crocker,P.R. and CC GPRFLN| Varki,A. CC GPRFLN| TITLE Cloning and characterization of human Siglec-11. A recently evolved CC GPRFLN| signaling that can interact with SHP-1 and SHP-2 and is expressed CC GPRFLN| by tissue macrophages, including brain microglia CC GPRFLN| JOURNAL J. Biol. Chem. 277 (27), 24466-24474 (2002) CC GPRFLN| MEDLINE 22086217 CC GPRFLN| REMARK GeneRIF: interacts with siglec-11 CC GPRFLN|REFERENCE 6 (residues 1 to 595) CC GPRFLN| AUTHORS Vyas,Y.M., Maniar,H. and Dupont,B. CC GPRFLN| TITLE Cutting edge: differential segregation of the SRC homology CC GPRFLN| 2-containing protein tyrosine phosphatase-1 within the early NK CC GPRFLN| cell immune synapse distinguishes noncytolytic from cytolytic CC GPRFLN| interactions CC GPRFLN| JOURNAL J. Immunol. 168 (7), 3150-3154 (2002) CC GPRFLN| MEDLINE 21904490 CC GPRFLN| REMARK GeneRIF: SHP-1 is recruited to the NK cell immune synapse within 1 CC GPRFLN| min in both cytolytic and noncytolytic conjugates, allowing clear CC GPRFLN| distinction between noncytolytic and cytolytic interactions at this CC GPRFLN| early time. CC GPRFLN|REFERENCE 7 (residues 1 to 595) CC GPRFLN| AUTHORS Kurita-Taniguchi,M., Hazeki,K., Murabayashi,N., Fukui,A., Tsuji,S., CC GPRFLN| Matsumoto,M., Toyoshima,K. and Seya,T. CC GPRFLN| TITLE Molecular assembly of CD46 with CD9, alpha3-beta1 integrin and CC GPRFLN| protein tyrosine phosphatase SHP-1 in human macrophages through CC GPRFLN| differentiation by GM-CSF CC GPRFLN| JOURNAL Mol. Immunol. 38 (9), 689-700 (2002) CC GPRFLN| MEDLINE 21848359 CC GPRFLN| REMARK GeneRIF: peripheral blood monocytes treated for 5--8 days with CC GPRFLN| GM-CSF (i.e. mature Mphi) acquired the capacity to assemble CC GPRFLN| tyrosine phosphatase SHP-1 with CD9, alpha3-beta1 integrin and CC GPRFLN| their CD46. CC GPRFLN|REFERENCE 8 (residues 1 to 595) CC GPRFLN| AUTHORS Blasioli,J. and Goodnow,C.C. CC GPRFLN| TITLE Lyn/CD22/SHP-1 and their importance in autoimmunity CC GPRFLN| JOURNAL Curr. Dir. Autoimmun. 5, 151-160 (2002) CC GPRFLN| MEDLINE 21685428 CC GPRFLN| REMARK GeneRIF: The Lyn/CD22/SHP-1 pathway is important in autoimmunity. CC GPRFLN| Naive and tolerant B-cells differ in their calcium signaling in CC GPRFLN| response to antigenic stimulation. CC GPRFLN|REFERENCE 9 (residues 1 to 595) CC GPRFLN| AUTHORS Jin,Y.J., Yu,C.L. and Burakoff,S.J. CC GPRFLN| TITLE Human 70-kDa SHP-1L differs from 68-kDa SHP-1 in its C-terminal CC GPRFLN| structure and catalytic activity CC GPRFLN| JOURNAL J. Biol. Chem. 274 (40), 28301-28307 (1999) CC GPRFLN| MEDLINE 99428497 CC GPRFLN|REFERENCE 10 (residues 1 to 595) CC GPRFLN| AUTHORS Bousquet,C., Delesque,N., Lopez,F., Saint-Laurent,N., Esteve,J.P., CC GPRFLN| Bedecs,K., Buscail,L., Vaysse,N. and Susini,C. CC GPRFLN| TITLE sst2 somatostatin receptor mediates negative regulation of insulin CC GPRFLN| receptor signaling through the tyrosine phosphatase SHP-1 CC GPRFLN| JOURNAL J. Biol. Chem. 273 (12), 7099-7106 (1998) CC GPRFLN| MEDLINE 98175983 CC GPRFLN|REFERENCE 11 (residues 1 to 595) CC GPRFLN| AUTHORS Blery,M., Kubagawa,H., Chen,C.C., Vely,F., Cooper,M.D. and CC GPRFLN| Vivier,E. CC GPRFLN| TITLE The paired Ig-like receptor PIR-B is an inhibitory receptor that CC GPRFLN| recruits the protein-tyrosine phosphatase SHP-1 CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 95 (5), 2446-2451 (1998) CC GPRFLN| MEDLINE 98151532 CC GPRFLN|REFERENCE 12 (residues 1 to 595) CC GPRFLN| AUTHORS Ono,M., Okada,H., Bolland,S., Yanagi,S., Kurosaki,T. and CC GPRFLN| Ravetch,J.V. CC GPRFLN| TITLE Deletion of SHIP or SHP-1 reveals two distinct pathways for CC GPRFLN| inhibitory signaling CC GPRFLN| JOURNAL Cell 90 (2), 293-301 (1997) CC GPRFLN| MEDLINE 97386454 CC GPRFLN|REFERENCE 13 (residues 1 to 595) CC GPRFLN| AUTHORS Li,R.Y., Gaits,F., Ragab,A., Ragab-Thomas,J.M. and Chap,H. CC GPRFLN| TITLE Tyrosine phosphorylation of an SH2-containing protein tyrosine CC GPRFLN| phosphatase is coupled to platelet thrombin receptor via a CC GPRFLN| pertussis toxin-sensitive heterotrimeric G-protein CC GPRFLN| JOURNAL EMBO J. 14 (11), 2519-2526 (1995) CC GPRFLN| MEDLINE 95300784 CC GPRFLN|REFERENCE 14 (residues 1 to 595) CC GPRFLN| AUTHORS Banville,D., Stocco,R. and Shen,S.H. CC GPRFLN| TITLE Human protein tyrosine phosphatase 1C (PTPN6) gene structure: CC GPRFLN| alternate promoter usage and exon skipping generate multiple CC GPRFLN| transcripts CC GPRFLN| JOURNAL Genomics 27 (1), 165-173 (1995) CC GPRFLN| MEDLINE 95394454 CC GPRFLN|REFERENCE 15 (residues 1 to 595) CC GPRFLN| AUTHORS Plutzky,J., Neel,B.G., Rosenberg,R.D., Eddy,R.L., Byers,M.G., CC GPRFLN| Jani-Sait,S. and Shows,T.B. CC GPRFLN| TITLE Chromosomal localization of an SH2-containing tyrosine phosphatase CC GPRFLN| (PTPN6) CC GPRFLN| JOURNAL Genomics 13 (3), 869-872 (1992) CC GPRFLN| MEDLINE 92347896 CC GPRFLN|REFERENCE 16 (residues 1 to 595) CC GPRFLN| AUTHORS Plutzky,J., Neel,B.G. and Rosenberg,R.D. CC GPRFLN| TITLE Isolation of a src homology 2-containing tyrosine phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (3), 1123-1127 (1992) CC GPRFLN| MEDLINE 92141214 CC GPRFLN|REFERENCE 17 (residues 1 to 595) CC GPRFLN| AUTHORS Yi,T.L., Cleveland,J.L. and Ihle,J.N. CC GPRFLN| TITLE Protein tyrosine phosphatase containing SH2 domains: CC GPRFLN| characterization, preferential expression in hematopoietic cells, CC GPRFLN| and localization to human chromosome 12p12-p13 CC GPRFLN| JOURNAL Mol. Cell. Biol. 12 (2), 836-846 (1992) CC GPRFLN| MEDLINE 92123209 CC GPRFLN|REFERENCE 18 (residues 1 to 595) CC GPRFLN| AUTHORS Shen,S.H., Bastien,L., Posner,B.I. and Chretien,P. CC GPRFLN| TITLE A protein-tyrosine phosphatase with sequence similarity to the SH2 CC GPRFLN| domain of the protein-tyrosine kinases CC GPRFLN| JOURNAL Nature 352 (6337), 736-739 (1991) CC GPRFLN| MEDLINE 91343005 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 297 VNTIFKEY:269 FT PROTEIN 1 297 protein-tyrosine phosphatase 1C; hematopoietic cell phophatase; hematopoietic cell protein-tyrosine phosphatase; 70 kda SHP-1L protein FT VNTIFKEY:270 FT REGION 23 297 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 297 AA; ADIENRVLEL NKKQESEDTA KAGFWEEFES LQKQEVKNLH QRLEGQRPEN KGKNRYKNIL 60 PFDHSRVILQ GRDSNIPGSD YINANYIKNQ LLGPDENAKT YIASQGCLEA TVNDFWQMAW 120 QENSRVIVMT TREVEKGRNK CVPYWPEVGM QRAYGPYSVT NCGEHDTTEY KLRTLQVSPL 180 DNGDLIREIW HYQYLSWPDH GVPSEPGGVL SFLDQINQRQ ESLPHAGPII VHCSAGIGRT 240 GTIIVIDMLM ENISTKGLDC DIDIQKTIQM VRAQRSGMVQ TEAQYKFIYV AIAQFIE 297 // ID hSHP2_D1\(NP_002825)\PTPN11 STANDARD;PRT; 300 AA. AC NP_002825; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 11 isoform 1; protein-tyrosine phosphatase 2C; Noonan syndrome 1; protein tyrosine phosphatase, non-receptor type 11 [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from D13540.1 and BF515187.1. CC On Jan 25, 2002 this sequence version replaced gi:13430846. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. PTPs are known to be CC signaling molecules that regulate a variety of cellular processes CC including cell growth, differentiation, mitotic cycle, and CC oncogenic transformation. This PTP contains two tandem Src CC homology-2 domains, which function as phospho-tyrosine binding CC domains and mediate the interaction of this PTP with its CC substrates. This PTP is widely expressed in most tissues and plays CC a regulatory role in various cell signaling events that are CC important for a diversity of cell functions, such as mitogenic CC activation, metabolic control, transcription regulation, and cell CC migration. Two alternatively spliced transcript variants of this CC gene, which encode distinct isoforms, have been described. CC CC Transcript Variant: This variant (1) contains a different 3' end CC region, and encodes a longer isoform (1), as compared to variant 2. CC GPRFLN|REFERENCE 1 (residues 1 to 593) CC GPRFLN| AUTHORS Yamazaki,S., Yamakawa,A., Ito,Y., Ohtani,M., Higashi,H., CC GPRFLN| Hatakeyama,M. and Azuma,T. CC GPRFLN| TITLE The CagA protein of Helicobacter pylori is translocated into CC GPRFLN| epithelial cells and binds to SHP-2 in human gastric mucosa CC GPRFLN| JOURNAL J. Infect. Dis. 187 (2), 334-337 (2003) CC GPRFLN| MEDLINE 22439942 CC GPRFLN| REMARK GeneRIF: The CagA protein of Helicobacter pylori is translocated CC GPRFLN| into epithelial cells and binds to SHP-2 in human gastric mucosa CC GPRFLN|REFERENCE 2 (residues 1 to 593) CC GPRFLN| AUTHORS Lehmann,U., Schmitz,J., Weissenbach,M., Sobota,R.M., Hortner,M., CC GPRFLN| Friederichs,K., Behrmann,I., Tsiaris,W., Sasaki,A., CC GPRFLN| Schneider-Mergener,J., Yoshimura,A., Neel,B.G., Heinrich,P.C. and CC GPRFLN| Schaper,F. CC GPRFLN| TITLE SHP2 and SOCS3 contribute to Tyr-759-dependent attenuation of CC GPRFLN| interleukin-6 signaling through gp130 CC GPRFLN| JOURNAL J. Biol. Chem. 278 (1), 661-671 (2003) CC GPRFLN| MEDLINE 22393451 CC GPRFLN| REMARK GeneRIF: These data suggest, that there are two, largely distinct CC GPRFLN| modes of negative regulation of gp130 activity, despite the fact CC GPRFLN| that both SOCS3 and SHP2 are recruited to the same site within CC GPRFLN| gp130. CC GPRFLN|REFERENCE 3 (residues 1 to 593) CC GPRFLN| AUTHORS Wu,T.R., Hong,Y.K., Wang,X.D., Ling,M.Y., Dragoi,A.M., Chung,A.S., CC GPRFLN| Campbell,A.G., Han,Z.Y., Feng,G.S. and Chin,Y.E. CC GPRFLN| TITLE SHP-2 is a dual-specificity phosphatase involved in Stat1 CC GPRFLN| dephosphorylation at both tyrosine and serine residues in nuclei CC GPRFLN| JOURNAL J. Biol. Chem. 277 (49), 47572-47580 (2002) CC GPRFLN| MEDLINE 22344627 CC GPRFLN| REMARK GeneRIF: SHP-2 is a dual-specificity protein phosphatase involved CC GPRFLN| in Stat1 dephosphorylation at both tyrosine and serine residues and CC GPRFLN| plays an important role in modulating STAT function in gene CC GPRFLN| regulation CC GPRFLN|REFERENCE 4 (residues 1 to 593) CC GPRFLN| AUTHORS Maile,L.A. and Clemmons,D.R. CC GPRFLN| TITLE The alphaVbeta3 integrin regulates insulin-like growth factor I CC GPRFLN| (IGF-I) receptor phosphorylation by altering the rate of CC GPRFLN| recruitment of the Src-homology 2-containing phosphotyrosine CC GPRFLN| phosphatase-2 to the activated IGF-I receptor CC GPRFLN| JOURNAL Endocrinology 143 (11), 4259-4264 (2002) CC GPRFLN| MEDLINE 22286240 CC GPRFLN| REMARK GeneRIF: activation state of alphaVbeta3 integrin is an important CC GPRFLN| regulator of the duration of insulin-like growth factor I receptor CC GPRFLN| phosphorylation and this regulation is mediated through changes in CC GPRFLN| the subcellular localization of SHP-2 CC GPRFLN|REFERENCE 5 (residues 1 to 593) CC GPRFLN| AUTHORS Ion,A., Tartaglia,M., Song,X., Kalidas,K., van der Burgt,I., CC GPRFLN| Shaw,A.C., Ming,J.E., Zampino,G., Zackai,E.H., Dean,J.C., Somer,M., CC GPRFLN| Parenti,G., Crosby,A.H., Patton,M.A., Gelb,B.D. and Jeffery,S. CC GPRFLN| TITLE Absence of PTPN11 mutations in 28 cases of cardiofaciocutaneous CC GPRFLN| (CFC) syndrome CC GPRFLN| JOURNAL Hum. Genet. 111 (4-5), 421-427 (2002) CC GPRFLN| MEDLINE 22271640 CC GPRFLN| REMARK GeneRIF: absence of mutation in cases of cardiofaciocutaneous CC GPRFLN| syndrome CC GPRFLN|REFERENCE 6 (residues 1 to 593) CC GPRFLN| AUTHORS Cai,T., Nishida,K., Hirano,T. and Khavari,P.A. CC GPRFLN| TITLE Gab1 and SHP-2 promote Ras/MAPK regulation of epidermal growth and CC GPRFLN| differentiation CC GPRFLN| JOURNAL J. Cell Biol. 159 (1), 103-112 (2002) CC GPRFLN| MEDLINE 22267353 CC GPRFLN| REMARK GeneRIF: Results indicate that Gab1 and SHP-2 promote the CC GPRFLN| undifferentiated epidermal cell state by facilitating Ras/MAPK CC GPRFLN| signaling. CC GPRFLN|REFERENCE 7 (residues 1 to 593) CC GPRFLN| AUTHORS Maheshwari,M., Belmont,J., Fernbach,S., Ho,T., Molinari,L., CC GPRFLN| Yakub,I., Yu,F., Combes,A., Towbin,J., Craigen,W.J. and Gibbs,R. CC GPRFLN| TITLE PTPN11 mutations in Noonan syndrome type I: detection of recurrent CC GPRFLN| mutations in exons 3 and 13 CC GPRFLN| JOURNAL Hum. Mutat. 20 (4), 298-304 (2002) CC GPRFLN| MEDLINE 22236043 CC GPRFLN| REMARK GeneRIF: Mutations in PTPN11/SHP2 underlie a common form of Noonan CC GPRFLN| syndrome and confirm that the disease exhibits both allelic and CC GPRFLN| locus heterogeneity. CC GPRFLN|REFERENCE 8 (residues 1 to 593) CC GPRFLN| AUTHORS Legius,E., Schrander-Stumpel,C., Schollen,E., CC GPRFLN| Pulles-Heintzberger,C., Gewillig,M. and Fryns,J.P. CC GPRFLN| TITLE PTPN11 mutations in LEOPARD syndrome CC GPRFLN| JOURNAL J. Med. Genet. 39 (8), 571-574 (2002) CC GPRFLN| MEDLINE 22151430 CC GPRFLN| REMARK GeneRIF: Some PTPN11 mutations (e.g., Y279C) are associated with CC GPRFLN| both the Noonan syndrome phenotype and with skin pigmentation CC GPRFLN| anomalies, such as multiple lentigines or caf## au lait spots CC GPRFLN| (LEOPARD syndrome). CC GPRFLN|REFERENCE 9 (residues 1 to 593) CC GPRFLN| AUTHORS Kosaki,K., Suzuki,T., Muroya,K., Hasegawa,T., Sato,S., Matsuo,N., CC GPRFLN| Kosaki,R., Nagai,T., Hasegawa,Y. and Ogata,T. CC GPRFLN| TITLE PTPN11 (protein-tyrosine phosphatase, nonreceptor-type 11) CC GPRFLN| mutations in seven Japanese patients with Noonan syndrome CC GPRFLN| JOURNAL J. Clin. Endocrinol. Metab. 87 (8), 3529-3533 (2002) CC GPRFLN| MEDLINE 22151235 CC GPRFLN| REMARK GeneRIF: PTPN11 mutations are responsible for Noonan syndrome in a CC GPRFLN| substantial fraction of patients and that relatively infrequent CC GPRFLN| features of Noonan syndrome, such as sensory deafness and bleeding CC GPRFLN| diathesis, can also result from mutations of PTPN11. CC GPRFLN|REFERENCE 10 (residues 1 to 593) CC GPRFLN| AUTHORS Angata,T., Kerr,S.C., Greaves,D.R., Varki,N.M., Crocker,P.R. and CC GPRFLN| Varki,A. CC GPRFLN| TITLE Cloning and characterization of human Siglec-11. A recently evolved CC GPRFLN| signaling that can interact with SHP-1 and SHP-2 and is expressed CC GPRFLN| by tissue macrophages, including brain microglia CC GPRFLN| JOURNAL J. Biol. Chem. 277 (27), 24466-24474 (2002) CC GPRFLN| MEDLINE 22086217 CC GPRFLN| REMARK GeneRIF: interacts with siglec-11 CC GPRFLN|REFERENCE 11 (residues 1 to 593) CC GPRFLN| AUTHORS Bordin,L., Brunati,A.M., Donella-Deana,A., Baggio,B., Toninello,A. CC GPRFLN| and Clari,G. CC GPRFLN| TITLE Band 3 is an anchor protein and a target for SHP-2 tyrosine CC GPRFLN| phosphatase in human erythrocytes CC GPRFLN| JOURNAL Blood 100 (1), 276-282 (2002) CC GPRFLN| MEDLINE 22065093 CC GPRFLN| REMARK GeneRIF: Band 3 is an anchor protein for and a target for SHP-2 CC GPRFLN| tyrosine phosphatase in human erythrocytes. CC GPRFLN|REFERENCE 12 (residues 1 to 593) CC GPRFLN| AUTHORS Tartaglia,M., Kalidas,K., Shaw,A., Song,X., Musat,D.L., van der CC GPRFLN| Burgt,I., Brunner,H.G., Bertola,D.R., Crosby,A., Ion,A., CC GPRFLN| Kucherlapati,R.S., Jeffery,S., Patton,M.A. and Gelb,B.D. CC GPRFLN| TITLE PTPN11 mutations in Noonan syndrome: molecular spectrum, CC GPRFLN| genotype-phenotype correlation, and phenotypic heterogeneity CC GPRFLN| JOURNAL Am. J. Hum. Genet. 70 (6), 1555-1563 (2002) CC GPRFLN| MEDLINE 21987645 CC GPRFLN| REMARK GeneRIF: PTPN11 mutations in Noonan syndrome: molecular spectrum, CC GPRFLN| genotype-phenotype correlation, and phenotypic heterogeneity. CC GPRFLN|REFERENCE 13 (residues 1 to 593) CC GPRFLN| AUTHORS Lacalle,R.A., Mira,E., Gomez-Mouton,C., Jimenez-Baranda,S., CC GPRFLN| Martinez-A,C. and Manes,S. CC GPRFLN| TITLE Specific SHP-2 partitioning in raft domains triggers CC GPRFLN| integrin-mediated signaling via Rho activation CC GPRFLN| JOURNAL J. Cell Biol. 157 (2), 277-289 (2002) CC GPRFLN| MEDLINE 21953171 CC GPRFLN| REMARK GeneRIF: Specific SHP-2 partitioning in raft domains triggers CC GPRFLN| integrin-mediated signaling via Rho activation CC GPRFLN|REFERENCE 14 (residues 1 to 593) CC GPRFLN| AUTHORS Ekman,S., Kallin,A., Engstrom,U., Heldin,C.H. and Ronnstrand,L. CC GPRFLN| TITLE SHP-2 is involved in heterodimer specific loss of phosphorylation CC GPRFLN| of Tyr771 in the PDGF beta-receptor CC GPRFLN| JOURNAL Oncogene 21 (12), 1870-1875 (2002) CC GPRFLN| MEDLINE 21906255 CC GPRFLN| REMARK GeneRIF: SHP-2 modulates phosphorylation of PDGF receptors, thereby CC GPRFLN| controls RasGTP recruitment and Ras/MAP kinase signaling in the CC GPRFLN| heterodimeric configuration of the PDGF receptors CC GPRFLN|REFERENCE 15 (residues 1 to 593) CC GPRFLN| AUTHORS Higashi,H., Tsutsumi,R., Muto,S., Sugiyama,T., Azuma,T., Asaka,M. CC GPRFLN| and Hatakeyama,M. CC GPRFLN| TITLE SHP-2 tyrosine phosphatase as an intracellular target of CC GPRFLN| Helicobacter pylori CagA protein CC GPRFLN| JOURNAL Science 295 (5555), 683-686 (2002) CC GPRFLN| MEDLINE 21669283 CC GPRFLN| REMARK GeneRIF: upon translocation, CagA perturbs cellular functions by CC GPRFLN| deregulating SHP-2 CC GPRFLN|REFERENCE 16 (residues 1 to 593) CC GPRFLN| AUTHORS Fukunaga,K., Noguchi,T., Takeda,H., Matozaki,T., Hayashi,Y., CC GPRFLN| Itoh,H. and Kasuga,M. CC GPRFLN| TITLE Requirement for protein-tyrosine phosphatase SHP-2 in CC GPRFLN| insulin-induced activation of c-Jun NH(2)-terminal kinase CC GPRFLN| JOURNAL J. Biol. Chem. 275 (7), 5208-5213 (2000) CC GPRFLN| MEDLINE 20138272 CC GPRFLN|REFERENCE 17 (residues 1 to 593) CC GPRFLN| AUTHORS Yu,C.L., Jin,Y.J. and Burakoff,S.J. CC GPRFLN| TITLE Cytosolic tyrosine dephosphorylation of STAT5. Potential role of CC GPRFLN| SHP-2 in STAT5 regulation CC GPRFLN| JOURNAL J. Biol. Chem. 275 (1), 599-604 (2000) CC GPRFLN| MEDLINE 20085083 CC GPRFLN|REFERENCE 18 (residues 1 to 593) CC GPRFLN| AUTHORS Li,C. and Friedman,J.M. CC GPRFLN| TITLE Leptin receptor activation of SH2 domain containing protein CC GPRFLN| tyrosine phosphatase 2 modulates Ob receptor signal transduction CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 96 (17), 9677-9682 (1999) CC GPRFLN| MEDLINE 99380578 CC GPRFLN|REFERENCE 19 (residues 1 to 593) CC GPRFLN| AUTHORS Manes,S., Mira,E., Gomez-Mouton,C., Zhao,Z.J., Lacalle,R.A. and CC GPRFLN| Martinez-A,C. CC GPRFLN| TITLE Concerted activity of tyrosine phosphatase SHP-2 and focal adhesion CC GPRFLN| kinase in regulation of cell motility CC GPRFLN| JOURNAL Mol. Cell. Biol. 19 (4), 3125-3135 (1999) CC GPRFLN| MEDLINE 99182500 CC GPRFLN|REFERENCE 20 (residues 1 to 593) CC GPRFLN| AUTHORS Takada,T., Matozaki,T., Takeda,H., Fukunaga,K., Noguchi,T., CC GPRFLN| Fujioka,Y., Okazaki,I., Tsuda,M., Yamao,T., Ochi,F. and Kasuga,M. CC GPRFLN| TITLE Roles of the complex formation of SHPS-1 with SHP-2 in CC GPRFLN| insulin-stimulated mitogen-activated protein kinase activation CC GPRFLN| JOURNAL J. Biol. Chem. 273 (15), 9234-9242 (1998) CC GPRFLN| MEDLINE 98204923 CC GPRFLN|REFERENCE 21 (residues 1 to 593) CC GPRFLN| AUTHORS Jamieson,C.R., van der Burgt,I., Brady,A.F., van Reen,M., CC GPRFLN| Elsawi,M.M., Hol,F., Jeffery,S., Patton,M.A. and Mariman,E. CC GPRFLN| TITLE Mapping a gene for Noonan syndrome to the long arm of chromosome 12 CC GPRFLN| JOURNAL Nat. Genet. 8 (4), 357-360 (1994) CC GPRFLN| MEDLINE 95201801 CC GPRFLN|REFERENCE 22 (residues 1 to 593) CC GPRFLN| AUTHORS Isobe,M., Hinoda,Y., Imai,K. and Adachi,M. CC GPRFLN| TITLE Chromosomal localization of an SH2 containing tyrosine phosphatase CC GPRFLN| (SH-PTP3) gene to chromosome 12q24.1 CC GPRFLN| JOURNAL Oncogene 9 (6), 1751-1753 (1994) CC GPRFLN| MEDLINE 94239755 CC GPRFLN|REFERENCE 23 (residues 1 to 593) CC GPRFLN| AUTHORS Bastien,L., Ramachandran,C., Liu,S. and Adam,M. CC GPRFLN| TITLE Cloning, expression and mutational analysis of SH-PTP2, human CC GPRFLN| protein-tyrosine phosphatase CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 196 (1), 124-133 (1993) CC GPRFLN| MEDLINE 94029983 CC GPRFLN|REFERENCE 24 (residues 1 to 593) CC GPRFLN| AUTHORS Ahmad,S., Banville,D., Zhao,Z., Fischer,E.H. and Shen,S.H. CC GPRFLN| TITLE A widely expressed human protein-tyrosine phosphatase containing CC GPRFLN| src homology 2 domains CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 90 (6), 2197-2201 (1993) CC GPRFLN| MEDLINE 93211929 CC GPRFLN|REFERENCE 25 (residues 1 to 593) CC GPRFLN| AUTHORS Vogel,W., Lammers,R., Huang,J. and Ullrich,A. CC GPRFLN| TITLE Activation of a phosphotyrosine phosphatase by tyrosine CC GPRFLN| phosphorylation CC GPRFLN| JOURNAL Science 259 (5101), 1611-1614 (1993) CC GPRFLN| MEDLINE 93206095 CC GPRFLN|REFERENCE 26 (residues 1 to 593) CC GPRFLN| AUTHORS Adachi,M., Sekiya,M., Miyachi,T., Matsuno,K., Hinoda,Y., Imai,K. CC GPRFLN| and Yachi,A. CC GPRFLN| TITLE Molecular cloning of a novel protein-tyrosine phosphatase SH-PTP3 CC GPRFLN| with sequence similarity to the src-homology region 2 CC GPRFLN| JOURNAL FEBS Lett. 314 (3), 335-339 (1992) CC GPRFLN| MEDLINE 93106179 CC GPRFLN|REFERENCE 27 (residues 1 to 593) CC GPRFLN| AUTHORS Freeman,R.M. Jr., Plutzky,J. and Neel,B.G. CC GPRFLN| TITLE Identification of a human src homology 2-containing CC GPRFLN| protein-tyrosine-phosphatase: a putative homolog of Drosophila CC GPRFLN| corkscrew CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (23), 11239-11243 (1992) CC GPRFLN| MEDLINE 93087502 CC GPRFLN|REFERENCE 28 (residues 1 to 593) CC GPRFLN| AUTHORS Adachi,M., Sekiya,M., Arimura,Y., Takekawa,M., Itoh,F., Hinoda,Y., CC GPRFLN| Imai,K. and Yachi,A. CC GPRFLN| TITLE Protein-tyrosine phosphatase expression in pre-B cell NALM-6 CC GPRFLN| JOURNAL Cancer Res. 52 (3), 737-740 (1992) CC GPRFLN| MEDLINE 92119637 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 300 VNTIFKEY:269 FT PROTEIN 1 300 protein-tyrosine phosphatase 2C; Noonan syndrome 1; protein tyrosine phosphatase, non-receptor type 11 FT VNTIFKEY:270 FT REGION 23 300 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 300 AA; AEIESRVREL SKLAETTDKV KQGFWEEFET LQQQECKLLY SRKEGQRQEN KNKNRYKNIL 60 PFDHTRVVLH DGDPNEPVSD YINANIIMPE FETKCNNSKP KKSYIATQGC LQNTVNDFWR 120 MVFQENSRVI VMTTKEVERG KSKCVKYWPD EYALKEYGVM RVRNVKESAA HDYTLRELKL 180 SKVGQGNTER TVWQYHFRTW PDHGVPSDPG GVLDFLEEVH HKQESIMDAG PVVVHCSAGI 240 GRTGTFIVID ILIDIIREKG VDCDIDVPKT IQMVRSQRSG MVQTEAQYRF IYMAVQHYIE 300 // ID hSTEP_D1\(NP_116170)\PTPN5 STANDARD;PRT; 276 AA. AC NP_116170; DT 17-MAY-2003 DE hypothetical protein FLJ14427 [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC PREDICTED REFSEQ: The mRNA record is supported by experimental CC evidence; however, the coding sequence is predicted. The reference CC sequence was derived from AK090923.1. CC On Aug 5, 2002 this sequence version replaced gi:14249442. CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Ninomiya,K., Wagatsuma,M., Kanda,K., Kondo,H., Yokoi,T., CC GPRFLN| Kodaira,H., Furuya,T., Takahashi,M., Kikkawa,E., Omura,Y., Abe,K., CC GPRFLN| Kamihara,K., Katsuta,N., Sato,K., Tanikawa,M., Yamazaki,M., CC GPRFLN| Sugiyama,T., Irie,R., Otsuki,T., Sato,H., Wakamatsu,A., Ishii,S., CC GPRFLN| Yamamoto,J., Isono,Y., Kawai-Hio,Y., Saito,K., Nishikawa,T., CC GPRFLN| Kimura,K., Yamashita,H., Matsuo,K., Nakamura,Y., Sekine,M., CC GPRFLN| Kikuchi,H., Murakawa,K., Kanehori,K., Takahashi-Fujii,A., CC GPRFLN| Oshima,A., Sugiyama,A., Kawakami,B., Suzuki,Y., Sugano,S., CC GPRFLN| Nagahari,K., Masuho,Y., Nagai,K. and Isogai,T. CC GPRFLN| TITLE NEDO human cDNA sequencing project CC GPRFLN| JOURNAL Unpublished CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 276 cloning vector: pME18SFL3 FT VNTIFKEY:269 FT PROTEIN 1 276 VNTIFKEY:270 FT REGION 18 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 276 AA; SRVLQAEELH EKALDPFLLQ AEFFEIPMNF VDPKEYDIPG LVRKNRYKTI LPNPHSRVCL 60 TSPDPDDPLS SYINANYIRG YGGEEKVYIA TQGPIVSTVA DFWRMVWQEH TPIIVMITNI 120 EEMNEKCTEY WPEEQVAYDG VEITVQKVIH TEDYRLRLIS LKSGTEERGL KHYWFTSWPD 180 QKTPDRAPPL LHLVREVEEA AQQEGPHCAP IIVHCSAGIG RTGCFIATSI CCQQLRQEGV 240 VDILKTTCQL RQDRGGMIQT CEQYQFVHHV MSLYEK 276 // ID hTCPTP_D1\(NP_002819)\PTPN2 STANDARD;PRT; 275 AA. AC NP_002819; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 2 isoform 1; T-cell protein tyrosine phosphatase [Homo sapiens]. OS Homo sapiens. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Hominidae; Homo. CC REVIEWED REFSEQ: This record has been curated by NCBI staff. The CC reference sequence was derived from M25393.1, AW592324.1 and CC BG699440.1. CC CC Summary: The protein encoded by this gene is a member of the CC protein tyrosine phosphatase (PTP) family. Members of the PTP CC family share a highly conserved catalytic motif, which is essential CC for the catalytic activity. PTPs are known to be signaling CC molecules that regulate a variety of cellular processes including CC cell growth, differentiation, mitotic cycle, and oncogenic CC transformation. Epidermal growth factor receptor and the adaptor CC protein Shc were reported to be substrates of this PTP, which CC suggested the roles in growth factor mediated cell signaling. Three CC alternatively spliced variants of this gene, which encode isoforms CC differing at their extreme C-termini, have been described. The CC different C-termini are thought to determine the substrate CC specificity, as well as the cellular localization of the isoforms. CC Two highly related but distinctly processed pseudogenes that CC localize to distinct chromosomes have been reported. CC CC Transcript Variant: This variant (1) contains a different 3' CC region, and encodes the longest isoform (1), as compared to variant CC 2 and 3. CC GPRFLN|REFERENCE 1 (residues 1 to 415) CC GPRFLN| AUTHORS Gupta,S., Radha,V., Sudhakar,Ch. and Swarup,G. CC GPRFLN| TITLE A nuclear protein tyrosine phosphatase activates p53 and induces CC GPRFLN| caspase-1-dependent apoptosis CC GPRFLN| JOURNAL FEBS Lett. 532 (1-2), 61-66 (2002) CC GPRFLN| MEDLINE 22347239 CC GPRFLN| REMARK GeneRIF: TCPTP activates p53 and induces caspase-1-dependent CC GPRFLN| apoptosis in a human tumor cell line. CC GPRFLN|REFERENCE 2 (residues 1 to 415) CC GPRFLN| AUTHORS Yamamoto,T., Sekine,Y., Kashima,K., Kubota,A., Sato,N., Aoki,N. and CC GPRFLN| Matsuda,T. CC GPRFLN| TITLE The nuclear isoform of protein-tyrosine phosphatase TC-PTP CC GPRFLN| regulates interleukin-6-mediated signaling pathway through STAT3 CC GPRFLN| dephosphorylation CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 297 (4), 811-817 (2002) CC GPRFLN| MEDLINE 22246068 CC GPRFLN| REMARK GeneRIF: regulates interleukin-6-mediated signaling pathway through CC GPRFLN| STAT3 dephosphorylation CC GPRFLN|REFERENCE 3 (residues 1 to 415) CC GPRFLN| AUTHORS Zhu,W., Mustelin,T. and David,M. CC GPRFLN| TITLE Arginine methylation of STAT1 regulates its dephosphorylation by T CC GPRFLN| cell protein tyrosine phosphatase CC GPRFLN| JOURNAL J. Biol. Chem. 277 (39), 35787-35790 (2002) CC GPRFLN| MEDLINE 22229439 CC GPRFLN| REMARK GeneRIF: TcPTP phosphorylation is regulated by STAT1 CC GPRFLN|REFERENCE 4 (residues 1 to 415) CC GPRFLN| AUTHORS ten Hoeve,J., de Jesus Ibarra-Sanchez,M., Fu,Y., Zhu,W., CC GPRFLN| Tremblay,M., David,M. and Shuai,K. CC GPRFLN| TITLE Identification of a nuclear Stat1 protein tyrosine phosphatase CC GPRFLN| JOURNAL Mol. Cell. Biol. 22 (16), 5662-5668 (2002) CC GPRFLN| MEDLINE 22133581 CC GPRFLN| REMARK GeneRIF: Results identify TC45 as a protein tyrosine phosphatase CC GPRFLN| responsible for the dephosphorylation of Stat1 in the nucleus. CC GPRFLN|REFERENCE 5 (residues 1 to 415) CC GPRFLN| AUTHORS Tiganis,T., Kemp,B.E. and Tonks,N.K. CC GPRFLN| TITLE The protein-tyrosine phosphatase TCPTP regulates epidermal growth CC GPRFLN| factor receptor-mediated and phosphatidylinositol CC GPRFLN| 3-kinase-dependent signaling CC GPRFLN| JOURNAL J. Biol. Chem. 274 (39), 27768-27775 (1999) CC GPRFLN| MEDLINE 99419063 CC GPRFLN|REFERENCE 6 (residues 1 to 415) CC GPRFLN| AUTHORS Tiganis,T., Bennett,A.M., Ravichandran,K.S. and Tonks,N.K. CC GPRFLN| TITLE Epidermal growth factor receptor and the adaptor protein p52Shc are CC GPRFLN| specific substrates of T-cell protein tyrosine phosphatase CC GPRFLN| JOURNAL Mol. Cell. Biol. 18 (3), 1622-1634 (1998) CC GPRFLN| MEDLINE 98147803 CC GPRFLN|REFERENCE 7 (residues 1 to 415) CC GPRFLN| AUTHORS Johnson,C.V., Cool,D.E., Glaccum,M.B., Green,N., Fischer,E.H., CC GPRFLN| Bruskin,A., Hill,D.E. and Lawrence,J.B. CC GPRFLN| TITLE Isolation and mapping of human T-cell protein tyrosine phosphatase CC GPRFLN| sequences: localization of genes and pseudogenes discriminated CC GPRFLN| using fluorescence hybridization with genomic versus cDNA probes CC GPRFLN| JOURNAL Genomics 16 (3), 619-629 (1993) CC GPRFLN| MEDLINE 93315152 CC GPRFLN|REFERENCE 8 (residues 1 to 415) CC GPRFLN| AUTHORS Mosinger,B. Jr., Tillmann,U., Westphal,H. and Tremblay,M.L. CC GPRFLN| TITLE Cloning and characterization of a mouse cDNA encoding a cytoplasmic CC GPRFLN| protein-tyrosine-phosphatase CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (2), 499-503 (1992) CC GPRFLN| MEDLINE 92115688 CC GPRFLN|REFERENCE 9 (residues 1 to 415) CC GPRFLN| AUTHORS Swarup,G., Kamatkar,S., Radha,V. and Rema,V. CC GPRFLN| TITLE Molecular cloning and expression of a protein-tyrosine phosphatase CC GPRFLN| showing homology with transcription factors Fos and Jun CC GPRFLN| JOURNAL FEBS Lett. 280 (1), 65-69 (1991) CC GPRFLN| MEDLINE 91184422 CC GPRFLN|REFERENCE 10 (residues 1 to 415) CC GPRFLN| AUTHORS Cool,D.E., Tonks,N.K., Charbonneau,H., Walsh,K.A., Fischer,E.H. and CC GPRFLN| Krebs,E.G. CC GPRFLN| TITLE cDNA isolated from a human T-cell library encodes a member of the CC GPRFLN| protein-tyrosine-phosphatase family CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 86 (14), 5257-5261 (1989) CC GPRFLN| MEDLINE 89315776 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302014800| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 T-cell protein tyrosine phosphatase FT VNTIFKEY:270 FT REGION 3 275 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 275 AA; TTIEREFEEL DTQRRWQPLY LEIRNESHDY PHRVAKFPEN RNRNRYRDVS PYDHSRVKLQ 60 NAENDYINAS LVDIEEAQRS YILTQGPLPN TCCHFWLMVW QQKTKAVVML NRIVEKESVK 120 CAQYWPTDDQ EMLFKETGFS VKLLSEDVKS YYTVHLLQLE NINSGETRTI SHFHYTTWPD 180 FGVPESPASF LNFLFKVRES GSLNPDHGPA VIHCSAGIGR SGTFSLVDTC LVLMEKGDDI 240 NIKQVLLNMR KYRMGLIQTP DQLRFSYMAI IEGAK 275 // ID macfaSTEP_D1\(BAB41172)_Fragm STANDARD;PRT; 184 AA. AC BAB41172; DT 26-JUN-2003 DE hypothetical protein [Macaca fascicularis]. OS Macaca fascicularis. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. CC Lab host: TOP10 CC Vector: pME18S-FL3 (Acc.No. AB009864) CC R. Site1: DraIII (CACTGTGTG) CC R. Site2: DraIII (CACCATGTG) CC Description: 1st strand cDNA was primed with an oligo(dT) primer CC [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was synthesized CC using specific 5' and 3' primers and amplified by PCR. The PCR CC product was digested with SfiI and size selection was performed to CC exclude fragments <1.5kb.The SfiI-digested PCR product was cloned CC into distinct DraIII sites of pME18S-FL3. XhoI sites just outside CC the DraIII sites can be used to isolate the cDNA insert. Libraries CC were constructed by oligo-capping method CC (Sugano et al., , Institute of Medical Science, University of CC Tokyo). CC Custom primer used for sequencing CC ( 5' end primer [CTTCTGCTCTAAAAGCTGCG]; CC 3' end primer [CGACCTGCAGCTCGAGCACA] ). CC GPRFLN|REFERENCE 1 CC GPRFLN| AUTHORS Osada,N., Hida,M., Kusuda,J., Tanuma,R., Hirata,M., Hirai,M., CC GPRFLN| Terao,K., Suzuki,Y., Sugano,S. and Hashimoto,K. CC GPRFLN| TITLE Prediction of unidentified human genes on the basis of sequence CC GPRFLN| similarity to novel cDNAs from cynomolgus monkey brain CC GPRFLN| JOURNAL Online Publication CC GPRFLN| REMARK Genome Biology 2001 3(1): research0006.1-0006.5; CC GPRFLN| http://genomebiology.com/2001/3/1/research/0006/ CC GPRFLN|REFERENCE 2 (residues 1 to 370) CC GPRFLN| AUTHORS Hashimoto,K., Osada,N., Hida,M., Kusuda,J. and Sugano,S. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (17-APR-2001) Katsuyuki Hashimoto, National Institute of CC GPRFLN| Infectious Diseases, Division of Genetic Resources; 23-1, Toyama CC GPRFLN| 1-chome, Shinjuku-ku, Tokyo 162-8640, Japan CC GPRFLN| (E-mail:khashi@nih.go.jp, URL:http://www.nih.go.jp/yoken/genebank/, CC GPRFLN| Tel:81-3-5285-1111(ex.2120), Fax:81-3-5285-1181) CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306377322| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 184 VNTIFKEY:269 FT PROTEIN 1 184 VNTIFKEY:270 SQ SEQUENCE 184 AA; SRVLQAEELH EKALDPFLLQ AEFFEIPMNF VDPKEYDIPG LVRKNRYKTI LPNPHSRVCL 60 TSPDPDDPLS SYINANYIRG YGGEEKVYIA TQGPIVSTVA DFWRMVWQEH TPIIVMITNI 120 EEMNEKCTEY WPEEQVVYDD VEITVQKVIH TEDYRLRLIS LKSGTEERGL KHYWFTSWPD 180 QKTP 184 // ID macmuPTPalpha_D2\(AAL40242)_Fragm STANDARD;PRT; 135 AA. AC AAL40242; DT 26-JUN-2003 DE receptor protein tyrosine phosphatase alpha [Macaca mulatta]. OS Macaca mulatta. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 135) CC GPRFLN| AUTHORS Brown,A.E. and Ojeda,S.R. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (27-SEP-2001) Neuroscience Division, Oregon Regional CC GPRFLN| Primate Research Center, Oregon Health and Sciences University, 505 CC GPRFLN| NW 185th Ave, Beaverton, OR 97006, USA CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|301970863| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 135 VNTIFKEY:269 FT PROTEIN 1 135 VNTIFKEY:270 SQ SEQUENCE 135 AA; RGEENTXYVN ASFIDGYRQK DSYIASQGPL LHTIEDFWRM IWEWKSCSIV MLTELEERGQ 60 EKCAQYWPSD GLVSYGDITV ELKKEEECES YTVRDLLVTN TRENKSRQIR QFHFHGWPEV 120 GIPSDGKGMI SIIAA 135 // ID macmuPTPzeta_D1\(AAL40258)_Fragm STANDARD;PRT; 69 AA. AC AAL40258; DT 26-JUN-2003 DE receptor-protein tyrosine phosphatase beta [Macaca mulatta]. OS Macaca mulatta. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 157) CC GPRFLN| AUTHORS Mungenast,A.E. and Ojeda,S.R. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (27-SEP-2001) Neuroscience Division, Oregon Regional CC GPRFLN| Primate Research Center, Oregon Health and Sciences University, 505 CC GPRFLN| NW 185th Ave, Beaverton, OR 97006, USA CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306375419| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 69 VNTIFKEY:269 FT PROTEIN 1 69 VNTIFKEY:270 SQ SEQUENCE 69 AA; SGACCRPLQC WSWKNRHVYC ARQYVAADST RRNCQHIWLL KHIRSQRNYL VQTEEQYVFI 60 HDTLVEAIL 69 // ID macmuPTPzeta_D2\(AAL40258)_Fragm STANDARD;PRT; 80 AA. AC AAL40258; DT 27-JUN-2003 DE receptor-protein tyrosine phosphatase beta [Macaca mulatta]. OS Macaca mulatta. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 157) CC GPRFLN| AUTHORS Mungenast,A.E. and Ojeda,S.R. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (27-SEP-2001) Neuroscience Division, Oregon Regional CC GPRFLN| Primate Research Center, Oregon Health and Sciences University, 505 CC GPRFLN| NW 185th Ave, Beaverton, OR 97006, USA CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306375478| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 80 VNTIFKEY:269 FT PROTEIN 1 80 VNTIFKEY:270 SQ SEQUENCE 80 AA; SHIHAYVNAL LIPGPTGKTK LEKQFQLLSQ SNIQQSDYST ALKQCNREKN RTSSIIPVER 60 SRVGISSLSG EGTDYINASY 80 // ID macneIA2beta_D1\(O02695) STANDARD;PRT; 279 AA. AC O02695; DT 26-JUN-2003 DE PROTEIN-TYROSINE PHOSPHATASE X PRECURSOR (R-PTP-X) (M1851). KW Hydrolase; Receptor; Glycoprotein; Signal; Transmembrane. OS Macaca nemestrina. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Primates; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. CC ------------------------------------------------------------------- CC This SWISS-PROT entry is copyright. It is produced through a CC collaboration between the Swiss Institute of Bioinformatics and CC the EMBL outstation - the European Bioinformatics Institute. CC The original entry is available from http://www.expasy.ch/sprot CC and http://www.ebi.ac.uk/sprot CC ------------------------------------------------------------------. CC [FUNCTION] IMPLICATED IN DEVELOPMENT OF NERVOUS SYSTEM AND CC PANCREATIC ENDOCRINE CELLS. CC [CATALYTIC ACTIVITY] PROTEIN TYROSINE PHOSPHATE + H(2)O = PROTEIN CC TYROSINE + ORTHOPHOSPHATE. CC [SUBCELLULAR LOCATION] TYPE I MEMBRANE PROTEIN (PROBABLE). CC [TISSUE SPECIFICITY] BRAIN, PROSTATE, PANCREATIC ISLETS. LOWER CC EXPRESSION IN SPINAL CORD, THYROID, ADRENAL MEDULLA AND CC GASTROINTESTINAL TRACT. CC [PTM] APPEARS TO UNDERGO MULTIPLE PROTEOLYTIC CLEAVAGE AT CC CONSECUTIVE BASIC RESIDUES (BY SIMILARITY). CC [SIMILARITY] CONTAINS 1 PROTEIN-TYROSINE PHOSPHATASE DOMAIN. CC GPRFLN|REFERENCE 1 (residues 1 to 1013) CC GPRFLN| AUTHORS LaGasse,J., Jelinek,L., Sexson,S., Lofton-Day,C., Breininger,J., CC GPRFLN| Sheppard,P., Kindsvogel,W. and Hagopian,W.A. CC GPRFLN| TITLE An islet-cell protein tyrosine phosphatase is a likely precursor to CC GPRFLN| the 37-kDa autoantigen in type 1 diabetes: human and macaque CC GPRFLN| sequences, tissue distribution, unique and shared epitopes, and CC GPRFLN| predictive autoantibodies CC GPRFLN| JOURNAL Mol. Med. 3 (3), 163-173 (1997) CC GPRFLN| MEDLINE 97254813 CC GPRFLN| REMARK SEQUENCE FROM N.A. CC GPRFLN| TISSUE=PANCREATIC ISLETS CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306376459| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT CHAIN 1 279 PROTEIN-TYROSINE PHOSPHATASE X. FT VNTIFKEY:203; VNTINAME:PTPRN2 FT DOMAIN 1 279 CYTOPLASMIC (POTENTIAL). FT VNTIFKEY:1004; VNTINAME:PTPRN2 FT DOMAIN 42 276 PROTEIN-TYROSINE PHOSPHATASE. FT VNTIFKEY:1000; VNTINAME:PTPRN2 FT ACT_SITE 217 217 POTENTIAL. FT VNTIFKEY:220; VNTINAME:PTPRN2 SQ SEQUENCE 279 AA; HMILSYMEDH LKNKNRLEKE WEALCAYQAE PNSSLVAQKE ENVPKNRSLA VLTYDHSRVL 60 LKAENSHSHS DYINASPIMD HDPRNPAYIA TQGPLPATVA DFWQMVWESG CVVIVMLTPL 120 TENGVRQCYH YWPDEGSNLY HIYEVNLVSE HIWCEDFLVR SFYLKNLQTN ETRTVTQFHF 180 LSWYDRGVPS SSRSLLDFRR KVNKCYRGRS CPIIVHCSDG AGRSGTYVLI DMVLNKMAKG 240 AKEIDIAATL EHLRDQRPGM VQTKEQFEFA LTAVAEEVN 279 // ID mCD45_D1\(NP_035340)\Ptprc STANDARD;PRT; 279 AA. AC NP_035340; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, C [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from M14342.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1152) CC GPRFLN| AUTHORS Irles,C., Symons,A., Michel,F., Bakker,T.R., van der Merwe,P.A. and CC GPRFLN| Acuto,O. CC GPRFLN| TITLE CD45 ectodomain controls interaction with GEMs and Lck activity for CC GPRFLN| optimal TCR signaling CC GPRFLN| JOURNAL Nat. Immunol. 4 (2), 189-197 (2003) CC GPRFLN| MEDLINE 22442648 CC GPRFLN| REMARK GeneRIF: the large CD45 ectodomain is required for optimal TCR CC GPRFLN| signaling CC GPRFLN|REFERENCE 2 (residues 1 to 1152) CC GPRFLN| AUTHORS Edmonds,S.D. and Ostergaard,H.L. CC GPRFLN| TITLE Dynamic association of CD45 with detergent-insoluble microdomains CC GPRFLN| in T lymphocytes CC GPRFLN| JOURNAL J. Immunol. 169 (9), 5036-5042 (2002) CC GPRFLN| MEDLINE 22278638 CC GPRFLN| REMARK GeneRIF: CD45 is present in lipid rafts in T cells before CC GPRFLN| activation, perhaps to activate raft-associated p56(lck), allowing CC GPRFLN| membrane-proximal signaling events to proceed. CC GPRFLN|REFERENCE 3 (residues 1 to 1152) CC GPRFLN| AUTHORS Freiberg,B.A., Kupfer,H., Maslanik,W., Delli,J., Kappler,J., CC GPRFLN| Zaller,D.M. and Kupfer,A. CC GPRFLN| TITLE Staging and resetting T cell activation in SMACs CC GPRFLN| JOURNAL Nat. Immunol. 3 (10), 911-917 (2002) CC GPRFLN| MEDLINE 22239831 CC GPRFLN| REMARK GeneRIF: we studied intracellular signaling in SMACs by CC GPRFLN| three-dimensional immunofluorescence microscopic localization of CC GPRFLN| CD3, CD45, talin, phosphotyrosine, Lck and phosphorylated ZAP-70 in CC GPRFLN| T cell-APC conjugates CC GPRFLN|REFERENCE 4 (residues 1 to 1152) CC GPRFLN| AUTHORS He,X., Woodford-Thomas,T.A., Johnson,K.G., Shah,D.D. and CC GPRFLN| Thomas,M.L. CC GPRFLN| TITLE Targeting of CD45 protein tyrosine phosphatase activity to lipid CC GPRFLN| microdomains on the T cell surface inhibits TCR signaling CC GPRFLN| JOURNAL Eur. J. Immunol. 32 (9), 2578-2587 (2002) CC GPRFLN| MEDLINE 22195589 CC GPRFLN| REMARK GeneRIF: Segregation of CD45 from proximal TCR signaling components CC GPRFLN| is necessary for TCR signaling and that the targeting of CD45 PTP CC GPRFLN| activity to lipid microdomains on the T cell surface results in CC GPRFLN| decreased sensitivity of TCR-mediated signaling. CC GPRFLN|REFERENCE 5 (residues 1 to 1152) CC GPRFLN| AUTHORS Bakker,T.R., Piperi,C., Davies,E.A. and Merwe,P.A. CC GPRFLN| TITLE Comparison of CD22 binding to native CD45 and synthetic CC GPRFLN| oligosaccharide CC GPRFLN| JOURNAL Eur. J. Immunol. 32 (7), 1924-1932 (2002) CC GPRFLN| MEDLINE 22110087 CC GPRFLN| REMARK GeneRIF: CD22 binding to native CD45 CC GPRFLN|REFERENCE 6 (residues 1 to 1152) CC GPRFLN| AUTHORS Martin,P., Del Hoyo,G.M., Anjuere,F., Arias,C.F., Vargas,H.H., CC GPRFLN| Fernandez-L,A., Parrillas,V. and Ardavin,C. CC GPRFLN| TITLE Characterization of a new subpopulation of mouse CD8alpha+ B220+ CC GPRFLN| dendritic cells endowed with type 1 interferon production capacity CC GPRFLN| and tolerogenic potential CC GPRFLN| JOURNAL Blood 100 (2), 383-390 (2002) CC GPRFLN| MEDLINE 22085803 CC GPRFLN| REMARK GeneRIF: Characterization of a new subpopulation of mouse CD8alpha+ CC GPRFLN| B220+ dendritic cells endowed with type 1 interferon production CC GPRFLN| capacity and tolerogenic potential. CC GPRFLN|REFERENCE 7 (residues 1 to 1152) CC GPRFLN| AUTHORS Fortin,M., Steff,A.M., Felberg,J., Ding,I., Schraven,B., Johnson,P. CC GPRFLN| and Hugo,P. CC GPRFLN| TITLE Apoptosis mediated through CD45 is independent of its phosphatase CC GPRFLN| activity and association with leukocyte phosphatase-associated CC GPRFLN| phosphoprotein CC GPRFLN| JOURNAL J. Immunol. 168 (12), 6084-6089 (2002) CC GPRFLN| MEDLINE 22050741 CC GPRFLN| REMARK GeneRIF: The extracellular and/or the transmembrane portion of CD45 CC GPRFLN| has a major role in apoptosis signaling which is independent of its CC GPRFLN| phosphatase activity and association with leukocyte CC GPRFLN| phosphatase-associated phosphoprotein. CC GPRFLN|REFERENCE 8 (residues 1 to 1152) CC GPRFLN| AUTHORS Tchilian,E.Z. and Beverley,P.C. CC GPRFLN| TITLE CD45 in memory and disease CC GPRFLN| JOURNAL Arch. Immunol. Ther. Exp. (Warsz.) 50 (2), 85-93 (2002) CC GPRFLN| MEDLINE 22017393 CC GPRFLN| REMARK GeneRIF: Role of high and low molecular weight isoforms of CD45 in CC GPRFLN| the function of na##ve and memory T lymphocytes. Review. CC GPRFLN|REFERENCE 9 (residues 1 to 1152) CC GPRFLN| AUTHORS Brooks,W.P. and Lynes,M.A. CC GPRFLN| TITLE Effects of hemizygous CD45 expression in the autoimmune CC GPRFLN| Fasl(gld/gld) syndrome CC GPRFLN| JOURNAL Cell. Immunol. 212 (1), 24-34 (2001) CC GPRFLN| MEDLINE 21573815 CC GPRFLN| REMARK GeneRIF: These data indicate that CD45 is essential to the CC GPRFLN| accumulation of CD4(-)/CD8(-) (DN) T cells in Fasl(gld/gld) mice CC GPRFLN|REFERENCE 10 (residues 1 to 1152) CC GPRFLN| AUTHORS Arendt,C.W. and Ostergaard,H.L. CC GPRFLN| TITLE Identification of the CD45-associated 116-kDa and 80-kDa proteins CC GPRFLN| as the alpha- and beta-subunits of alpha-glucosidase II CC GPRFLN| JOURNAL J. Biol. Chem. 272 (20), 13117-13125 (1997) CC GPRFLN| MEDLINE 97294720 CC GPRFLN|REFERENCE 11 (residues 1 to 1152) CC GPRFLN| AUTHORS Zebedee,S.L., Barritt,D.S. and Raschke,W.C. CC GPRFLN| TITLE Comparison of mouse Ly5a and Ly5b leucocyte common antigen alleles CC GPRFLN| JOURNAL Dev. Immunol. 1 (4), 243-254 (1991) CC GPRFLN| MEDLINE 92361152 CC GPRFLN|REFERENCE 12 (residues 1 to 1152) CC GPRFLN| AUTHORS Raschke,W.C. CC GPRFLN| TITLE Cloned murine T200 (Ly-5) cDNA reveals multiple transcripts within CC GPRFLN| B- and T-lymphocyte lineages CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 84 (1), 161-165 (1987) CC GPRFLN| MEDLINE 87092355 CC GPRFLN|REFERENCE 13 (residues 1 to 1152) CC GPRFLN| AUTHORS Saga,Y., Tung,J.S., Shen,F.W. and Boyse,E.A. CC GPRFLN| TITLE Sequences of Ly-5 cDNA: isoform-related diversity of Ly-5 mRNA CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 83 (18), 6940-6944 (1986) CC GPRFLN| MEDLINE 86313686 CC GPRFLN|REFERENCE 14 (residues 1 to 1152) CC GPRFLN| AUTHORS Shen,F.W., Saga,Y., Litman,G., Freeman,G., Tung,J.S., Cantor,H. and CC GPRFLN| Boyse,E.A. CC GPRFLN| TITLE Cloning of Ly-5 cDNA CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 82 (21), 7360-7363 (1985) CC GPRFLN| MEDLINE 86042665 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302132248| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT REGION 17 277 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; DILLETYKRK IADEGRLFLA EFQSIPRVFS KFPIKDARKP HNQNKNRYVD ILPYDYNRVE 60 LSEINGDAGS TYINASYIDG FKEPRKYIAA QGPRDETVDD FWRMIWEQKA TVIVMVTRCE 120 EGNRNKCAEY WPSMEEGTRA FKDIVVTIND HKRCPDYIIQ KLNVAHKKEK ATGREVTHIQ 180 FTSWPDHGVP EDPHLLLKLR RRVNAFSNFF SGPIVVHCSA GVGRTGTYIG IDAMLEGLEA 240 EGKVDVYGYV VKLRRQRCLM VQVEAQYILI HQALVEYNQ 279 // ID mCD45_D2\(NP_035340)\Ptprc STANDARD;PRT; 307 AA. AC NP_035340; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, C [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from M14342.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1152) CC GPRFLN| AUTHORS Irles,C., Symons,A., Michel,F., Bakker,T.R., van der Merwe,P.A. and CC GPRFLN| Acuto,O. CC GPRFLN| TITLE CD45 ectodomain controls interaction with GEMs and Lck activity for CC GPRFLN| optimal TCR signaling CC GPRFLN| JOURNAL Nat. Immunol. 4 (2), 189-197 (2003) CC GPRFLN| MEDLINE 22442648 CC GPRFLN| REMARK GeneRIF: the large CD45 ectodomain is required for optimal TCR CC GPRFLN| signaling CC GPRFLN|REFERENCE 2 (residues 1 to 1152) CC GPRFLN| AUTHORS Edmonds,S.D. and Ostergaard,H.L. CC GPRFLN| TITLE Dynamic association of CD45 with detergent-insoluble microdomains CC GPRFLN| in T lymphocytes CC GPRFLN| JOURNAL J. Immunol. 169 (9), 5036-5042 (2002) CC GPRFLN| MEDLINE 22278638 CC GPRFLN| REMARK GeneRIF: CD45 is present in lipid rafts in T cells before CC GPRFLN| activation, perhaps to activate raft-associated p56(lck), allowing CC GPRFLN| membrane-proximal signaling events to proceed. CC GPRFLN|REFERENCE 3 (residues 1 to 1152) CC GPRFLN| AUTHORS Freiberg,B.A., Kupfer,H., Maslanik,W., Delli,J., Kappler,J., CC GPRFLN| Zaller,D.M. and Kupfer,A. CC GPRFLN| TITLE Staging and resetting T cell activation in SMACs CC GPRFLN| JOURNAL Nat. Immunol. 3 (10), 911-917 (2002) CC GPRFLN| MEDLINE 22239831 CC GPRFLN| REMARK GeneRIF: we studied intracellular signaling in SMACs by CC GPRFLN| three-dimensional immunofluorescence microscopic localization of CC GPRFLN| CD3, CD45, talin, phosphotyrosine, Lck and phosphorylated ZAP-70 in CC GPRFLN| T cell-APC conjugates CC GPRFLN|REFERENCE 4 (residues 1 to 1152) CC GPRFLN| AUTHORS He,X., Woodford-Thomas,T.A., Johnson,K.G., Shah,D.D. and CC GPRFLN| Thomas,M.L. CC GPRFLN| TITLE Targeting of CD45 protein tyrosine phosphatase activity to lipid CC GPRFLN| microdomains on the T cell surface inhibits TCR signaling CC GPRFLN| JOURNAL Eur. J. Immunol. 32 (9), 2578-2587 (2002) CC GPRFLN| MEDLINE 22195589 CC GPRFLN| REMARK GeneRIF: Segregation of CD45 from proximal TCR signaling components CC GPRFLN| is necessary for TCR signaling and that the targeting of CD45 PTP CC GPRFLN| activity to lipid microdomains on the T cell surface results in CC GPRFLN| decreased sensitivity of TCR-mediated signaling. CC GPRFLN|REFERENCE 5 (residues 1 to 1152) CC GPRFLN| AUTHORS Bakker,T.R., Piperi,C., Davies,E.A. and Merwe,P.A. CC GPRFLN| TITLE Comparison of CD22 binding to native CD45 and synthetic CC GPRFLN| oligosaccharide CC GPRFLN| JOURNAL Eur. J. Immunol. 32 (7), 1924-1932 (2002) CC GPRFLN| MEDLINE 22110087 CC GPRFLN| REMARK GeneRIF: CD22 binding to native CD45 CC GPRFLN|REFERENCE 6 (residues 1 to 1152) CC GPRFLN| AUTHORS Martin,P., Del Hoyo,G.M., Anjuere,F., Arias,C.F., Vargas,H.H., CC GPRFLN| Fernandez-L,A., Parrillas,V. and Ardavin,C. CC GPRFLN| TITLE Characterization of a new subpopulation of mouse CD8alpha+ B220+ CC GPRFLN| dendritic cells endowed with type 1 interferon production capacity CC GPRFLN| and tolerogenic potential CC GPRFLN| JOURNAL Blood 100 (2), 383-390 (2002) CC GPRFLN| MEDLINE 22085803 CC GPRFLN| REMARK GeneRIF: Characterization of a new subpopulation of mouse CD8alpha+ CC GPRFLN| B220+ dendritic cells endowed with type 1 interferon production CC GPRFLN| capacity and tolerogenic potential. CC GPRFLN|REFERENCE 7 (residues 1 to 1152) CC GPRFLN| AUTHORS Fortin,M., Steff,A.M., Felberg,J., Ding,I., Schraven,B., Johnson,P. CC GPRFLN| and Hugo,P. CC GPRFLN| TITLE Apoptosis mediated through CD45 is independent of its phosphatase CC GPRFLN| activity and association with leukocyte phosphatase-associated CC GPRFLN| phosphoprotein CC GPRFLN| JOURNAL J. Immunol. 168 (12), 6084-6089 (2002) CC GPRFLN| MEDLINE 22050741 CC GPRFLN| REMARK GeneRIF: The extracellular and/or the transmembrane portion of CD45 CC GPRFLN| has a major role in apoptosis signaling which is independent of its CC GPRFLN| phosphatase activity and association with leukocyte CC GPRFLN| phosphatase-associated phosphoprotein. CC GPRFLN|REFERENCE 8 (residues 1 to 1152) CC GPRFLN| AUTHORS Tchilian,E.Z. and Beverley,P.C. CC GPRFLN| TITLE CD45 in memory and disease CC GPRFLN| JOURNAL Arch. Immunol. Ther. Exp. (Warsz.) 50 (2), 85-93 (2002) CC GPRFLN| MEDLINE 22017393 CC GPRFLN| REMARK GeneRIF: Role of high and low molecular weight isoforms of CD45 in CC GPRFLN| the function of na##ve and memory T lymphocytes. Review. CC GPRFLN|REFERENCE 9 (residues 1 to 1152) CC GPRFLN| AUTHORS Brooks,W.P. and Lynes,M.A. CC GPRFLN| TITLE Effects of hemizygous CD45 expression in the autoimmune CC GPRFLN| Fasl(gld/gld) syndrome CC GPRFLN| JOURNAL Cell. Immunol. 212 (1), 24-34 (2001) CC GPRFLN| MEDLINE 21573815 CC GPRFLN| REMARK GeneRIF: These data indicate that CD45 is essential to the CC GPRFLN| accumulation of CD4(-)/CD8(-) (DN) T cells in Fasl(gld/gld) mice CC GPRFLN|REFERENCE 10 (residues 1 to 1152) CC GPRFLN| AUTHORS Arendt,C.W. and Ostergaard,H.L. CC GPRFLN| TITLE Identification of the CD45-associated 116-kDa and 80-kDa proteins CC GPRFLN| as the alpha- and beta-subunits of alpha-glucosidase II CC GPRFLN| JOURNAL J. Biol. Chem. 272 (20), 13117-13125 (1997) CC GPRFLN| MEDLINE 97294720 CC GPRFLN|REFERENCE 11 (residues 1 to 1152) CC GPRFLN| AUTHORS Zebedee,S.L., Barritt,D.S. and Raschke,W.C. CC GPRFLN| TITLE Comparison of mouse Ly5a and Ly5b leucocyte common antigen alleles CC GPRFLN| JOURNAL Dev. Immunol. 1 (4), 243-254 (1991) CC GPRFLN| MEDLINE 92361152 CC GPRFLN|REFERENCE 12 (residues 1 to 1152) CC GPRFLN| AUTHORS Raschke,W.C. CC GPRFLN| TITLE Cloned murine T200 (Ly-5) cDNA reveals multiple transcripts within CC GPRFLN| B- and T-lymphocyte lineages CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 84 (1), 161-165 (1987) CC GPRFLN| MEDLINE 87092355 CC GPRFLN|REFERENCE 13 (residues 1 to 1152) CC GPRFLN| AUTHORS Saga,Y., Tung,J.S., Shen,F.W. and Boyse,E.A. CC GPRFLN| TITLE Sequences of Ly-5 cDNA: isoform-related diversity of Ly-5 mRNA CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 83 (18), 6940-6944 (1986) CC GPRFLN| MEDLINE 86313686 CC GPRFLN|REFERENCE 14 (residues 1 to 1152) CC GPRFLN| AUTHORS Shen,F.W., Saga,Y., Litman,G., Freeman,G., Tung,J.S., Cantor,H. and CC GPRFLN| Boyse,E.A. CC GPRFLN| TITLE Cloning of Ly-5 cDNA CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 82 (21), 7360-7363 (1985) CC GPRFLN| MEDLINE 86042665 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141369| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 307 VNTIFKEY:269 FT PROTEIN 1 307 VNTIFKEY:270 FT REGION 22 303 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 307 AA; SELHSCLHNM KKRDPPSDPS PREAEYQRLP SYRSWRTQHI GNQGENKKKK RNSNVVPYDF 60 NRVPLKHELE MSKESEPESD ESSDDDSDSE ETSKYINASF VMSYWKPEMM IAAQGPLKET 120 IGDFWQMIFQ RKVKVIVMLT ELVNGDQEVC AQYWGEGKQT YGDMEVEMKD TNRASAYTLR 180 TFELRHSKRK EPRTVYQYQC TTWKGEELPA EPKDLVSMIQ DLKQKLPKAS PEGMKYHKHA 240 SILVHCRDGS QQTGLFCALF NLLESAETED VVDVFQVVKS LRKARPGVVC SYEQYQFLYD 300 IIASIYP 307 // ID mDEP1_D1\(NP_033008)\Ptprj STANDARD;PRT; 277 AA. AC NP_033008; DT 27-JUN-2003 DE protein tyrosine phosphatase, receptor type, J; colon tumor susceptibility 1 [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from AY038891.1. CC GPRFLN|REFERENCE 1 (residues 1 to 1238) CC GPRFLN| AUTHORS Takahashi,T., Takahashi,K., St John,P.L., Fleming,P.A., CC GPRFLN| Tomemori,T., Watanabe,T., Abrahamson,D.R., Drake,C.J., Shirasawa,T. CC GPRFLN| and Daniel,T.O. CC GPRFLN| TITLE A mutant receptor tyrosine phosphatase, CD148, causes defects in CC GPRFLN| vascular development CC GPRFLN| JOURNAL Mol. Cell. Biol. 23 (5), 1817-1831 (2003) CC GPRFLN| MEDLINE 22477405 CC GPRFLN| REMARK GeneRIF: CD148 has a role in developmental vascular organization CC GPRFLN| and regulates endothelial proliferation and endothelium-pericyte CC GPRFLN| interactions CC GPRFLN|REFERENCE 2 (residues 1 to 1238) CC GPRFLN| AUTHORS Ruivenkamp,C.A., van Wezel,T., Zanon,C., Stassen,A.P., Vlcek,C., CC GPRFLN| Csikos,T., Klous,A.M., Tripodis,N., Perrakis,A., Boerrigter,L., CC GPRFLN| Groot,P.C., Lindeman,J., Mooi,W.J., Meijjer,G.A., Scholten,G., CC GPRFLN| Dauwerse,H., Paces,V., van Zandwijk,N., van Ommen,G.J. and CC GPRFLN| Demant,P. CC GPRFLN| TITLE Ptprj is a candidate for the mouse colon-cancer susceptibility CC GPRFLN| locus Scc1 and is frequently deleted in human cancers CC GPRFLN| JOURNAL Nat. Genet. 31 (3), 295-300 (2002) CC GPRFLN| MEDLINE 22084388 CC GPRFLN| REMARK GeneRIF: This protein is a candidate for the mouse colon cancer CC GPRFLN| susceptibility locus (Scc1). CC GPRFLN|REFERENCE 3 (residues 1 to 1238) CC GPRFLN| AUTHORS Kuramochi,S., Matsuda,S., Matsuda,Y., Saitoh,T., Ohsugi,M. and CC GPRFLN| Yamamoto,T. CC GPRFLN| TITLE Molecular cloning and characterization of Byp, a murine CC GPRFLN| receptor-type tyrosine phosphatase similar to human DEP-1 CC GPRFLN| JOURNAL FEBS Lett. 378 (1), 7-14 (1996) CC GPRFLN| MEDLINE 96140699 CC GPRFLN|REFERENCE 4 (residues 1 to 1238) CC GPRFLN| AUTHORS van Wezel,T., Ruivenkamp,C.A.L., Zanon,C., Stassen,A.P.M., CC GPRFLN| Vlcek,C., Csikos,T., Tripodis,N., Groot,P.C., Dauwerse,H., van CC GPRFLN| Ommen,G.J.B. and Demant,P. CC GPRFLN| TITLE Positional cloning identifies Ptprj as the candidate for colon CC GPRFLN| cancer susceptibility QTL Scc1 CC GPRFLN| JOURNAL Unpublished CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306456187| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 277 VNTIFKEY:269 FT PROTEIN 1 277 colon tumor susceptibility 1 FT VNTIFKEY:270 FT REGION 17 277 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 277 AA; ENFEAYFKKQ QADSNCGFAE EYEDLKLIGI SLPKYTAEIA ENRGKNRYNN VLPYDISRVK 60 LSVQTHSTDD YINANYMPGY HSKKDFIATQ GPLPNTLKDF WRMVWEKNVY AIVMLTKCVE 120 QGRTKCEEYW PSKQAQDYGD ITVAMTSEVV LPEWTIRDFV VKNMQNSESH PLRQFHFTSW 180 PDHGVPDTTD LLINFRYLVR DYMKQIPPES PILVHCSAGV GRTGTFIAID RLIYQIENEN 240 TVDVYGIVYD LRMHRPLMVQ TEDQYVFLNQ CVLDIIR 277 // ID mHDPTP_D1\(AAH22721) STANDARD;PRT; 286 AA. AC AAH22721; DT 30-JUN-2003 DE AI462446 protein [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC Contact: MGC help desk CC Email: cgapbs-r@mail.nih.gov CC Tissue Procurement: The Cepko Laboratory CC cDNA Library Preparation: Life Technologies, Inc. CC cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL) CC DNA Sequencing by: Sequencing Group at the Stanford Human Genome CC Center, Stanford University School of Medicine, Stanford, CA 94305 CC Web site: http://www-shgc.stanford.edu CC Contact: (Dickson, Mark) mcd@paxil.stanford.edu CC Dickson, M., Schmutz, J., Grimwood, J., Rodriquez, A., and Myers, CC R. M. CC CC Clone distribution: MGC clone distribution information can be found CC through the I.M.A.G.E. Consortium/LLNL at: http://image.llnl.gov CC Series: IRAK Plate: 44 Row: e Column: 12 CC This clone was selected for full length sequencing because it CC passed the following selection criteria: Hexamer frequency ORF CC analysis. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 496) CC GPRFLN| AUTHORS Strausberg,R.L., Feingold,E.A., Grouse,L.H., Derge,J.G., CC GPRFLN| Klausner,R.D., Collins,F.S., Wagner,L., Shenmen,C.M., Schuler,G.D., CC GPRFLN| Altschul,S.F., Zeeberg,B., Buetow,K.H., Schaefer,C.F., Bhat,N.K., CC GPRFLN| Hopkins,R.F., Jordan,H., Moore,T., Max,S.I., Wang,J., Hsieh,F., CC GPRFLN| Diatchenko,L., Marusina,K., Farmer,A.A., Rubin,G.M., Hong,L., CC GPRFLN| Stapleton,M., Soares,M.B., Bonaldo,M.F., Casavant,T.L., CC GPRFLN| Scheetz,T.E., Brownstein,M.J., Usdin,T.B., Toshiyuki,S., CC GPRFLN| Carninci,P., Prange,C., Raha,S.S., Loquellano,N.A., Peters,G.J., CC GPRFLN| Abramson,R.D., Mullahy,S.J., Bosak,S.A., McEwan,P.J., CC GPRFLN| McKernan,K.J., Malek,J.A., Gunaratne,P.H., Richards,S., CC GPRFLN| Worley,K.C., Hale,S., Garcia,A.M., Gay,L.J., Hulyk,S.W., CC GPRFLN| Villalon,D.K., Muzny,D.M., Sodergren,E.J., Lu,X., Gibbs,R.A., CC GPRFLN| Fahey,J., Helton,E., Ketteman,M., Madan,A., Rodrigues,S., CC GPRFLN| Sanchez,A., Whiting,M., Madan,A., Young,A.C., Shevchenko,Y., CC GPRFLN| Bouffard,G.G., Blakesley,R.W., Touchman,J.W., Green,E.D., CC GPRFLN| Dickson,M.C., Rodriguez,A.C., Grimwood,J., Schmutz,J., Myers,R.M., CC GPRFLN| Butterfield,Y.S., Krzywinski,M.I., Skalska,U., Smailus,D.E., CC GPRFLN| Schnerch,A., Schein,J.E., Jones,S.J. and Marra,M.A. CC GPRFLN| TITLE Generation and initial analysis of more than 15,000 full-length CC GPRFLN| human and mouse cDNA sequences CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002) CC GPRFLN| MEDLINE 22388257 CC GPRFLN|REFERENCE 2 (residues 1 to 496) CC GPRFLN| AUTHORS Strausberg,R. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (01-FEB-2002) National Institutes of Health, Mammalian CC GPRFLN| Gene Collection (MGC), Cancer Genomics Office, National Cancer CC GPRFLN| Institute, 31 Center Drive, Room 11A03, Bethesda, MD 20892-2590, CC GPRFLN| USA CC GPRFLN| REMARK NIH-MGC Project URL: http://mgc.nci.nih.gov CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306769633| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|UNKNOWN| FT SOURCE 1 286 Vector: pCMV-SPORT6 FT VNTIFKEY:269 FT PROTEIN 1 286 VNTIFKEY:270 SQ SEQUENCE 286 AA; ERLQQLQQEL EAFRGQLGDA GALDAIWREL QEAQEHDARG RSIAIARCYS LKNRHQDVMP 60 YDSNRVVLRS GKDDYINASC VEGLSPYCPP LVATQAPLPG TAADFWLMVH EQKVSVIVML 120 VSEAEMEKQK VARYFPTERG QPMVHGALSV ALSSIRTTET HVERVLSLQF RDQSLKRSLV 180 HLHFPTWPEL GLPDSPGNLL RFIQEVHAHY LHQRPLHTPI VVHCSSGVGR TGAFALLYAA 240 VQEVEAGNGI PELPQLVRRM RQQRKHMLQE KLHLKFCHEA LVRHVE 286 // ID mHePTP_D1\(NP_796055)\Ptpn7 STANDARD;PRT; 272 AA. AC NP_796055; DT 30-JUN-2003 DE RIKEN cDNA C920001D21 gene [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PREDICTED REFSEQ: The mRNA record is supported by experimental CC evidence; however, the coding sequence is predicted. The reference CC sequence was derived from AK083305.1. CC GPRFLN|REFERENCE 1 (residues 1 to 359) CC GPRFLN| AUTHORS Okazaki,Y., Furuno,M., Kasukawa,T., Adachi,J., Bono,H., Kondo,S., CC GPRFLN| Nikaido,I., Osato,N., Saito,R., Suzuki,H., Yamanaka,I., CC GPRFLN| Kiyosawa,H., Yagi,K., Tomaru,Y., Hasegawa,Y., Nogami,A., CC GPRFLN| Schonbach,C., Gojobori,T., Baldarelli,R., Hill,D.P., Bult,C., CC GPRFLN| Hume,D.A., Quackenbush,J., Schriml,L.M., Kanapin,A., Matsuda,H., CC GPRFLN| Batalov,S., Beisel,K.W., Blake,J.A., Bradt,D., Brusic,V., CC GPRFLN| Chothia,C., Corbani,L.E., Cousins,S., Dalla,E., Dragani,T.A., CC GPRFLN| Fletcher,C.F., Forrest,A., Frazer,K.S., Gaasterland,T., CC GPRFLN| Gariboldi,M., Gissi,C., Godzik,A., Gough,J., Grimmond,S., CC GPRFLN| Gustincich,S., Hirokawa,N., Jackson,I.J., Jarvis,E.D., Kanai,A., CC GPRFLN| Kawaji,H., Kawasawa,Y., Kedzierski,R.M., King,B.L., Konagaya,A., CC GPRFLN| Kurochkin,I.V., Lee,Y., Lenhard,B., Lyons,P.A., Maglott,D.R., CC GPRFLN| Maltais,L., Marchionni,L., McKenzie,L., Miki,H., Nagashima,T., CC GPRFLN| Numata,K., Okido,T., Pavan,W.J., Pertea,G., Pesole,G., CC GPRFLN| Petrovsky,N., Pillai,R., Pontius,J.U., Qi,D., Ramachandran,S., CC GPRFLN| Ravasi,T., Reed,J.C., Reed,D.J., Reid,J., Ring,B.Z., Ringwald,M., CC GPRFLN| Sandelin,A., Schneider,C., Semple,C.A., Setou,M., Shimada,K., CC GPRFLN| Sultana,R., Takenaka,Y., Taylor,M.S., Teasdale,R.D., Tomita,M., CC GPRFLN| Verardo,R., Wagner,L., Wahlestedt,C., Wang,Y., Watanabe,Y., CC GPRFLN| Wells,C., Wilming,L.G., Wynshaw-Boris,A., Yanagisawa,M., Yang,I., CC GPRFLN| Yang,L., Yuan,Z., Zavolan,M., Zhu,Y., Zimmer,A., Carninci,P., CC GPRFLN| Hayatsu,N., Hirozane-Kishikawa,T., Konno,H., Nakamura,M., CC GPRFLN| Sakazume,N., Sato,K., Shiraki,T., Waki,K., Kawai,J., Aizawa,K., CC GPRFLN| Arakawa,T., Fukuda,S., Hara,A., Hashizume,W., Imotani,K., Ishii,Y., CC GPRFLN| Itoh,M., Kagawa,I., Miyazaki,A., Sakai,K., Sasaki,D., Shibata,K., CC GPRFLN| Shinagawa,A., Yasunishi,A., Yoshino,M., Waterston,R., Lander,E.S., CC GPRFLN| Rogers,J., Birney,E. and Hayashizaki,Y. CC GPRFLN| TITLE Analysis of the mouse transcriptome based on functional annotation CC GPRFLN| of 60,770 full-length cDNAs CC GPRFLN| JOURNAL Nature 420 (6915), 563-573 (2002) CC GPRFLN| MEDLINE 22354683 CC GPRFLN|REFERENCE 2 CC GPRFLN| AUTHORS The FANTOM Consortium and the RIKEN Genome Exploration Research CC GPRFLN| Group Phase I & II Team. CC GPRFLN| TITLE Analysis of the mouse transcriptome based on functional annotation CC GPRFLN| of 60,770 full-length cDNAs CC GPRFLN| JOURNAL Nature 420, 563-573 (2002) CC GPRFLN|REFERENCE 3 CC GPRFLN| AUTHORS Kawai,J., Shinagawa,A., Shibata,K., Yoshino,M., Itoh,M., Ishii,Y., CC GPRFLN| Arakawa,T., Hara,A., Fukunishi,Y., Konno,H., Adachi,J., Fukuda,S., CC GPRFLN| Aizawa,K., Izawa,M., Nishi,K., Kiyosawa,H., Kondo,S., Yamanaka,I., CC GPRFLN| Saito,T., Okazaki,Y., Gojobori,T., Bono,H., Kasukawa,T., Saito,R., CC GPRFLN| Kadota,K., Matsuda,H., Ashburner,M., Batalov,S., Casavant,T., CC GPRFLN| Fleischmann,W., Gaasterland,T., Gissi,C., King,B., Kochiwa,H., CC GPRFLN| Kuehl,P., Lewis,S., Matsuo,Y., Nikaido,I., Pesole,G., CC GPRFLN| Quackenbush,J., Schriml,L.M., Staubli,F., Suzuki,R., Tomita,M., CC GPRFLN| Wagner,L., Washio,T., Sakai,K., Okido,T., Furuno,M., Aono,H., CC GPRFLN| Baldarelli,R., Barsh,G., Blake,J., Boffelli,D., Bojunga,N., CC GPRFLN| Carninci,P., de Bonaldo,M.F., Brownstein,M.J., Bult,C., CC GPRFLN| Fletcher,C., Fujita,M., Gariboldi,M., Gustincich,S., Hill,D., CC GPRFLN| Hofmann,M., Hume,D.A., Kamiya,M., Lee,N.H., Lyons,P., CC GPRFLN| Marchionni,L., Mashima,J., Mazzarelli,J., Mombaerts,P., Nordone,P., CC GPRFLN| Ring,B., Ringwald,M., Rodriguez,I., Sakamoto,N., Sasaki,H., CC GPRFLN| Sato,K., Schonbach,C., Seya,T., Shibata,Y., Storch,K.F., Suzuki,H., CC GPRFLN| Toyo-oka,K., Wang,K.H., Weitz,C., Whittaker,C., Wilming,L., CC GPRFLN| Wynshaw-Boris,A., Yoshida,K., Hasegawa,Y., Kawaji,H., Kohtsuki,S. CC GPRFLN| and Hayashizaki,Y. CC GPRFLN| TITLE Functional annotation of a full-length mouse cDNA collection CC GPRFLN| JOURNAL Nature 409 (6821), 685-690 (2001) CC GPRFLN| MEDLINE 21085660 CC GPRFLN|REFERENCE 4 CC GPRFLN| AUTHORS Shibata,K., Itoh,M., Aizawa,K., Nagaoka,S., Sasaki,N., Carninci,P., CC GPRFLN| Konno,H., Akiyama,J., Nishi,K., Kitsunai,T., Tashiro,H., Itoh,M., CC GPRFLN| Sumi,N., Ishii,Y., Nakamura,S., Hazama,M., Nishine,T., Harada,A., CC GPRFLN| Yamamoto,R., Matsumoto,H., Sakaguchi,S., Ikegami,T., Kashiwagi,K., CC GPRFLN| Fujiwake,S., Inoue,K. and Togawa,Y. CC GPRFLN| TITLE RIKEN integrated sequence analysis (RISA) system--384-format CC GPRFLN| sequencing pipeline with 384 multicapillary sequencer CC GPRFLN| JOURNAL Genome Res. 10 (11), 1757-1771 (2000) CC GPRFLN| MEDLINE 20530913 CC GPRFLN|REFERENCE 5 CC GPRFLN| AUTHORS Carninci,P., Shibata,Y., Hayatsu,N., Sugahara,Y., Shibata,K., CC GPRFLN| Itoh,M., Konno,H., Okazaki,Y., Muramatsu,M. and Hayashizaki,Y. CC GPRFLN| TITLE Normalization and subtraction of cap-trapper-selected cDNAs to CC GPRFLN| prepare full-length cDNA libraries for rapid discovery of new genes CC GPRFLN| JOURNAL Genome Res. 10 (10), 1617-1630 (2000) CC GPRFLN| MEDLINE 20499374 CC GPRFLN|REFERENCE 6 CC GPRFLN| AUTHORS Carninci,P. and Hayashizaki,Y. CC GPRFLN| TITLE High-efficiency full-length cDNA cloning CC GPRFLN| JOURNAL Meth. Enzymol. 303, 19-44 (1999) CC GPRFLN| MEDLINE 99279253 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306769567| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|UNKNOWN| FT SOURCE 1 272 VNTIFKEY:269 FT PROTEIN 1 272 VNTIFKEY:270 FT REGION 17 270 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 272 AA; HPLTRWTLQH QPPSPKQLEE EFLKIPSNFV NPEDLDIPGH ASKDRYKTIL PNPQSRVCLG 60 RAQSQEDSDY INANYIRGYD GKEKVYIATQ GPMPNTVADF WEMVWQEDVS LIVMLTQLRE 120 GKEKCVHYWP TEEEAYGPFQ IRIQDMKEHP EYTVRQLTIQ HQQECRSVKH ILFSAWPDHQ 180 TPESAGPLLR LVAEVETPET AANSGPIVVH CSAGIGRTGC FIATRIGCQQ LKARGEVDIL 240 GIVCQLRLDR GGMIQTAEQY QFLHHTLALY AA 272 // ID mIA2_D1\(NP_033011)\Ptprn STANDARD;PRT; 279 AA. AC NP_033011; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, N; protein tyrosine phosphatase, receptor-type, N [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from X74438.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 996) CC GPRFLN| AUTHORS Saeki,K., Zhu,M., Kubosaki,A., Xie,J., Lan,M.S. and Notkins,A.L. CC GPRFLN| TITLE Targeted disruption of the protein tyrosine phosphatase-like CC GPRFLN| molecule IA-2 results in alterations in glucose tolerance tests and CC GPRFLN| insulin secretion CC GPRFLN| JOURNAL Diabetes 51 (6), 1842-1850 (2002) CC GPRFLN| MEDLINE 22027598 CC GPRFLN| REMARK GeneRIF: IA-2 is involved in glucose-stimulated insulin secretion CC GPRFLN|REFERENCE 2 (residues 1 to 996) CC GPRFLN| AUTHORS Kudva,Y.C., Deng,Y.J., Govindarajan,R., Abraham,R.S., CC GPRFLN| Marietta,E.V., Notkins,A.L. and David,C.S. CC GPRFLN| TITLE HLA-DQ8 transgenic and NOD mice recognize different epitopes within CC GPRFLN| the cytoplasmic region of the tyrosine phosphatase-like molecule, CC GPRFLN| IA-2 CC GPRFLN| JOURNAL Hum. Immunol. 62 (10), 1099-1105 (2001) CC GPRFLN| MEDLINE 21486216 CC GPRFLN| REMARK GeneRIF: IA-2 peptides have been identified that induce CC GPRFLN| lymphoproliferative responses in DQ8 transgenic and NOD mice and CC GPRFLN| stimulate production of Th1 and Th2 cytokines. CC GPRFLN|REFERENCE 3 (residues 1 to 996) CC GPRFLN| AUTHORS Ehringer,M.A., Thompson,J., Conroy,O., Xu,Y., Yang,F., Canniff,J., CC GPRFLN| Beeson,M., Gordon,L., Bennett,B., Johnson,T.E. and Sikela,J.M. CC GPRFLN| TITLE High-throughput sequence identification of gene coding variants CC GPRFLN| within alcohol-related QTLs CC GPRFLN| JOURNAL Mamm. Genome 12 (8), 657-663 (2001) CC GPRFLN| MEDLINE 21363810 CC GPRFLN|REFERENCE 4 (residues 1 to 996) CC GPRFLN| AUTHORS Saeki,K., Xie,J. and Notkins,A.L. CC GPRFLN| TITLE Genomic structure of mouse IA-2: comparison with its human CC GPRFLN| homologue CC GPRFLN| JOURNAL Diabetologia 43 (11), 1429-1434 (2000) CC GPRFLN| MEDLINE 21012487 CC GPRFLN|REFERENCE 5 CC GPRFLN| AUTHORS Magistrelli,G., Covini,N., Mosca,M., Lippoli,G. and Isacchi,A. CC GPRFLN| TITLE Expression of PTP35, the murine homologue of the protein tyrosine CC GPRFLN| phosphatase-related sequence IA-2, is regulated during cell growth CC GPRFLN| and stimulated by mitogens in 3T3 fibroblasts CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 217 (1), 154-161 (1995) CC GPRFLN| MEDLINE 96095652 CC GPRFLN|REFERENCE 6 (residues 1 to 996) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302142060| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 protein tyrosine phosphatase, receptor-type, N FT VNTIFKEY:270 FT REGION 17 278 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; HMILAYMEDH LRNRDRLAKE WQALCAYQAE PNTCAAAQDE SNIKKNRHPD FLPYDHARIK 60 LKVESSPSRS DYINASPIIE HDPRMPAYIA TQGPLSHTIA DFWQMVWESG CTVIVMLTPL 120 VEDGVKQCDR YWPDEGSSLY HVYEVNLVSE HIWCEDFLVR SFYLKNVQTQ ETRTLTQFHF 180 LSWPAEGTPA STRPLLDFRR KVNKCYRGRS CPIIVHCSDG AGRTGTYILI DMVLNRMAKG 240 VKEIDIAATL EHVRDQRPGL VRSKDQFEFA LTAVAEEVN 279 // ID mLAR_D1\(NP_035343)\Ptprf STANDARD;PRT; 275 AA. AC NP_035343; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, F; protein tyrosine phosphatase, receptor-type, F [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from AF300943.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1898) CC GPRFLN| AUTHORS Zeng,L., Si,X., Yu,W.P., Le,H.T., Ng,K.P., Teng,R.M., Ryan,K., CC GPRFLN| Wang,D.Z., Ponniah,S. and Pallen,C.J. CC GPRFLN| TITLE PTP alpha regulates integrin-stimulated FAK autophosphorylation and CC GPRFLN| cytoskeletal rearrangement in cell spreading and migration CC GPRFLN| JOURNAL J. Cell Biol. 160 (1), 137-146 (2003) CC GPRFLN| MEDLINE 22403956 CC GPRFLN| REMARK GeneRIF: PTP alpha is required for integrin-proximal events and CC GPRFLN| phosphorylates FAK CC GPRFLN|REFERENCE 2 (residues 1 to 1898) CC GPRFLN| AUTHORS Terszowski,G., Jankowski,A., Hendriks,W.J., Rolink,A.G. and CC GPRFLN| Kisielow,P. CC GPRFLN| TITLE Within the hemopoietic system, LAR phosphatase is a T cell CC GPRFLN| lineage-specific adhesion receptor-like protein whose phosphatase CC GPRFLN| activity appears dispensable for T cell development, repertoire CC GPRFLN| selection and function CC GPRFLN| JOURNAL Eur. J. Immunol. 31 (3), 832-840 (2001) CC GPRFLN| MEDLINE 21135493 CC GPRFLN|REFERENCE 3 (residues 1 to 1898) CC GPRFLN| AUTHORS Schaapveld,R.Q., van den Maagdenberg,A.M., Schepens,J.T., CC GPRFLN| Weghuis,D.O., Geurts van Kessel,A., Wieringa,B. and Hendriks,W.J. CC GPRFLN| TITLE The mouse gene Ptprf encoding the leukocyte common antigen-related CC GPRFLN| molecule LAR: cloning, characterization, and chromosomal CC GPRFLN| localization CC GPRFLN| JOURNAL Genomics 27 (1), 124-130 (1995) CC GPRFLN| MEDLINE 95394448 CC GPRFLN|REFERENCE 4 (residues 1 to 1898) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 5 (residues 1 to 1898) CC GPRFLN| AUTHORS Schepens,J., Zeeuwen,P., Wieringa,B. and Hendriks,W. CC GPRFLN| TITLE Identification and typing of members of the protein-tyrosine CC GPRFLN| phosphatase gene family expressed in mouse brain CC GPRFLN| JOURNAL Mol. Biol. Rep. 16 (4), 241-248 (1992) CC GPRFLN| MEDLINE 93086603 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302132731| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 protein tyrosine phosphatase, receptor-type, F FT VNTIFKEY:270 FT REGION 17 275 PTPc FT VNTIFKEY:266; VNTINAME:Region_4 SQ SEQUENCE 275 AA; TDLADNIERL KANDGLKFSQ EYESIDPGQQ FTWENSNSEV NKPKNRYADV IAYDHSRVLL 60 TSIDGVPGSD YINANYIDGY RKQNAYIATQ GPLPETMGDF WRMVWEQRTA TVVMMTRLEE 120 KSRVKCDQYW PVRGTETYGL IQVTLVDTVE LATYTMRTFA LHKSGSSEKR ELRQFQFMAW 180 PDHGVPEYPT PILAFLRRVK ACNPLDAGPM VVHCSAGVGR TGCFIVIDAM LERMKHEKTV 240 DIYGHVTCMR SQRNYMVQTE DQYVFIHEAL LEAAM 275 // ID mLAR_D2\(NP_035343)\Ptprf STANDARD;PRT; 283 AA. AC NP_035343; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, F; protein tyrosine phosphatase, receptor-type, F [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from AF300943.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1898) CC GPRFLN| AUTHORS Zeng,L., Si,X., Yu,W.P., Le,H.T., Ng,K.P., Teng,R.M., Ryan,K., CC GPRFLN| Wang,D.Z., Ponniah,S. and Pallen,C.J. CC GPRFLN| TITLE PTP alpha regulates integrin-stimulated FAK autophosphorylation and CC GPRFLN| cytoskeletal rearrangement in cell spreading and migration CC GPRFLN| JOURNAL J. Cell Biol. 160 (1), 137-146 (2003) CC GPRFLN| MEDLINE 22403956 CC GPRFLN| REMARK GeneRIF: PTP alpha is required for integrin-proximal events and CC GPRFLN| phosphorylates FAK CC GPRFLN|REFERENCE 2 (residues 1 to 1898) CC GPRFLN| AUTHORS Terszowski,G., Jankowski,A., Hendriks,W.J., Rolink,A.G. and CC GPRFLN| Kisielow,P. CC GPRFLN| TITLE Within the hemopoietic system, LAR phosphatase is a T cell CC GPRFLN| lineage-specific adhesion receptor-like protein whose phosphatase CC GPRFLN| activity appears dispensable for T cell development, repertoire CC GPRFLN| selection and function CC GPRFLN| JOURNAL Eur. J. Immunol. 31 (3), 832-840 (2001) CC GPRFLN| MEDLINE 21135493 CC GPRFLN|REFERENCE 3 (residues 1 to 1898) CC GPRFLN| AUTHORS Schaapveld,R.Q., van den Maagdenberg,A.M., Schepens,J.T., CC GPRFLN| Weghuis,D.O., Geurts van Kessel,A., Wieringa,B. and Hendriks,W.J. CC GPRFLN| TITLE The mouse gene Ptprf encoding the leukocyte common antigen-related CC GPRFLN| molecule LAR: cloning, characterization, and chromosomal CC GPRFLN| localization CC GPRFLN| JOURNAL Genomics 27 (1), 124-130 (1995) CC GPRFLN| MEDLINE 95394448 CC GPRFLN|REFERENCE 4 (residues 1 to 1898) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 5 (residues 1 to 1898) CC GPRFLN| AUTHORS Schepens,J., Zeeuwen,P., Wieringa,B. and Hendriks,W. CC GPRFLN| TITLE Identification and typing of members of the protein-tyrosine CC GPRFLN| phosphatase gene family expressed in mouse brain CC GPRFLN| JOURNAL Mol. Biol. Rep. 16 (4), 241-248 (1992) CC GPRFLN| MEDLINE 93086603 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141738| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 283 VNTIFKEY:269 FT PROTEIN 1 283 protein tyrosine phosphatase, receptor-type, F FT VNTIFKEY:270 FT REGION 25 282 PTPc FT VNTIFKEY:266; VNTINAME:Region_5 SQ SEQUENCE 283 AA; RNLYAHIQKL GQVPPGESVT AMELEFKLLA NSKAHTSRFV SANLPCNKFK NRLVNIMPYE 60 LTRVCLQPIR GVEGSDYINA SFLDGYRQQK AYIATQGPLA ESTEDFWRML WEHNSTIIVM 120 LTKLREMGRE KCHQYWPAER SARYQYFVVD PMAEYNMPQY ILREFKVTDA RDGQSRTIRQ 180 FQFTDWPEQG VPKTGEGFID XIGQVHKTKE QFGQDGPITV HCSAGVGRTG VFITLSIVLE 240 RMRYEGVVDM FQTVKTLRTQ RPAMVQTEDQ YQLCYRAALE YLG 283 // ID mMEG1_D1\(NP_064317)\Ptpn4 STANDARD;PRT; 277 AA. AC NP_064317; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 4; testis-enriched protein tyrosine phosphatase; TEP/mPTPMEG; testis-enriched phosphatase; protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from AF106702.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 926) CC GPRFLN| AUTHORS Park,K.W., Lee,E.J., Lee,S., Lee,J.E., Choi,E., Kim,B.J., Hwang,R., CC GPRFLN| Park,K.A. and Baik,J. CC GPRFLN| TITLE Molecular cloning and characterization of a protein tyrosine CC GPRFLN| phosphatase enriched in testis, a putative murine homologue of CC GPRFLN| human PTPMEG CC GPRFLN| JOURNAL Gene 257 (1), 45-55 (2000) CC GPRFLN| MEDLINE 20510023 CC GPRFLN|REFERENCE 2 (residues 1 to 926) CC GPRFLN| AUTHORS Celler,J.W., Luo,X. and Bohmer,F.D. CC GPRFLN| TITLE Protein tyrosine phosphatase gene expression analysis in Swiss 3T3 CC GPRFLN| fibroblasts CC GPRFLN| JOURNAL Mol. Cell. Biochem. 178 (1-2), 157-162 (1998) CC GPRFLN| MEDLINE 98206672 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302142016| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 277 VNTIFKEY:269 FT PROTEIN 1 277 similar to Homo sapiens megakaryocyte PTPase MEG-01; non-receptor type PTPase; contains Band 4.1-like and catalytic phosphatase domains; contains SH3 and DHR (PDZ) motifs that function as adaptor sequences; testis-enriched protein tyrosine phosphatase; TEP/mPTPMEG; testis-enriched phosphatase; protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) FT VNTIFKEY:270 FT REGION 19 277 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 277 AA; HSLRESMIQL AEGLITGTVL AQFDQLYRKK PGMTMSCAKL PQNISKNRYR DISPYDATRV 60 LLKGNEDYIN ANYINMEIPS SSIINQYIAC QGPLPHTCKD FWQMIWEQGS SMVVMLTTQV 120 ERGRVKCHQY WPEPSESSSY GCYQATCHSE EGNPAYIFRK MTLINQEKNE SRQLTQIQYT 180 AWPDHGVPDD SSDFLDFVCH VRDQRAGKEE PIIVHCSAGI GRTGVLITME TAMCLIECNQ 240 PVYPLDIVRT MRDQRAMMIQ TPSQYRFVCE AILKVYE 277 // ID mMEG2_D1\(NP_062625)\Ptpn9 STANDARD;PRT; 291 AA. AC NP_062625; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 9; protein-tyrosine phosphatase [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from AF013490.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 593) CC GPRFLN| AUTHORS Kawai,J., Shinagawa,A., Shibata,K., Yoshino,M., Itoh,M., Ishii,Y., CC GPRFLN| Arakawa,T., Hara,A., Fukunishi,Y., Konno,H., Adachi,J., Fukuda,S., CC GPRFLN| Aizawa,K., Izawa,M., Nishi,K., Kiyosawa,H., Kondo,S., Yamanaka,I., CC GPRFLN| Saito,T., Okazaki,Y., Gojobori,T., Bono,H., Kasukawa,T., Saito,R., CC GPRFLN| Kadota,K., Matsuda,H., Ashburner,M., Batalov,S., Casavant,T., CC GPRFLN| Fleischmann,W., Gaasterland,T., Gissi,C., King,B., Kochiwa,H., CC GPRFLN| Kuehl,P., Lewis,S., Matsuo,Y., Nikaido,I., Pesole,G., CC GPRFLN| Quackenbush,J., Schriml,L.M., Staubli,F., Suzuki,R., Tomita,M., CC GPRFLN| Wagner,L., Washio,T., Sakai,K., Okido,T., Furuno,M., Aono,H., CC GPRFLN| Baldarelli,R., Barsh,G., Blake,J., Boffelli,D., Bojunga,N., CC GPRFLN| Carninci,P., de Bonaldo,M.F., Brownstein,M.J., Bult,C., CC GPRFLN| Fletcher,C., Fujita,M., Gariboldi,M., Gustincich,S., Hill,D., CC GPRFLN| Hofmann,M., Hume,D.A., Kamiya,M., Lee,N.H., Lyons,P., CC GPRFLN| Marchionni,L., Mashima,J., Mazzarelli,J., Mombaerts,P., Nordone,P., CC GPRFLN| Ring,B., Ringwald,M., Rodriguez,I., Sakamoto,N., Sasaki,H., CC GPRFLN| Sato,K., Schonbach,C., Seya,T., Shibata,Y., Storch,K.F., Suzuki,H., CC GPRFLN| Toyo-oka,K., Wang,K.H., Weitz,C., Whittaker,C., Wilming,L., CC GPRFLN| Wynshaw-Boris,A., Yoshida,K., Hasegawa,Y., Kawaji,H., Kohtsuki,S. CC GPRFLN| and Hayashizaki,Y. CC GPRFLN| TITLE Functional annotation of a full-length mouse cDNA collection CC GPRFLN| JOURNAL Nature 409 (6821), 685-690 (2001) CC GPRFLN| MEDLINE 21085660 CC GPRFLN|REFERENCE 2 (residues 1 to 593) CC GPRFLN| AUTHORS Shibata,K., Itoh,M., Aizawa,K., Nagaoka,S., Sasaki,N., Carninci,P., CC GPRFLN| Konno,H., Akiyama,J., Nishi,K., Kitsunai,T., Tashiro,H., Itoh,M., CC GPRFLN| Sumi,N., Ishii,Y., Nakamura,S., Hazama,M., Nishine,T., Harada,A., CC GPRFLN| Yamamoto,R., Matsumoto,H., Sakaguchi,S., Ikegami,T., Kashiwagi,K., CC GPRFLN| Fujiwake,S., Inoue,K. and Togawa,Y. CC GPRFLN| TITLE RIKEN integrated sequence analysis (RISA) system--384-format CC GPRFLN| sequencing pipeline with 384 multicapillary sequencer CC GPRFLN| JOURNAL Genome Res. 10 (11), 1757-1771 (2000) CC GPRFLN| MEDLINE 20530913 CC GPRFLN|REFERENCE 3 (residues 1 to 593) CC GPRFLN| AUTHORS Carninci,P., Shibata,Y., Hayatsu,N., Sugahara,Y., Shibata,K., CC GPRFLN| Itoh,M., Konno,H., Okazaki,Y., Muramatsu,M. and Hayashizaki,Y. CC GPRFLN| TITLE Normalization and subtraction of cap-trapper-selected cDNAs to CC GPRFLN| prepare full-length cDNA libraries for rapid discovery of new genes CC GPRFLN| JOURNAL Genome Res. 10 (10), 1617-1630 (2000) CC GPRFLN| MEDLINE 20499374 CC GPRFLN|REFERENCE 4 (residues 1 to 593) CC GPRFLN| AUTHORS Carninci,P. and Hayashizaki,Y. CC GPRFLN| TITLE High-efficiency full-length cDNA cloning CC GPRFLN| JOURNAL Meth. Enzymol. 303, 19-44 (1999) CC GPRFLN| MEDLINE 99279253 CC GPRFLN|REFERENCE 5 (residues 1 to 593) CC GPRFLN| AUTHORS Meng,K., Gu,M., Li,F.N., Veile,R.A., Donis-Keller,H. and CC GPRFLN| Majerus,P.W. CC GPRFLN| TITLE MPTP-MEG2 CC GPRFLN| JOURNAL Unpublished CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141969| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 291 VNTIFKEY:269 FT PROTEIN 1 291 protein-tyrosine phosphatase FT VNTIFKEY:270 FT REGION 17 291 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 291 AA; MTIQELVDYV NTRQKRGIYE EYEDICLENP VGTFHRTMSP RNLEKNRYGD VPCLDQTRVK 60 LTKRSGHTQT DYINASFMDG YKQKNAYNGT QGPLENTYRD FWLMVWEQKV LVIVMTTRFE 120 EGGRRKCGQY WPLEKDSRIR FGFLTVTNLG VENMNHYKKT TLEIHNTEER QKRQVTHFQF 180 LSWPDYGVPS SAASLIDFLR VVRNQQSMAV GNMGARSKGQ CPEPPIVVHC SAGIGRTGTF 240 CSLDICLAQL EELGTLNVFH TVSRMRTQRA FSIQTPEQYY FCYKAILEFA Q 291 // ID mPEP_D1\(NP_033005)\Ptpn8 STANDARD;PRT; 287 AA. AC NP_033005; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 8 [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from M90388.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 802) CC GPRFLN| AUTHORS Matthews,R.J., Bowne,D.B., Flores,E. and Thomas,M.L. CC GPRFLN| TITLE Characterization of hematopoietic intracellular protein tyrosine CC GPRFLN| phosphatases: description of a phosphatase containing an SH2 domain CC GPRFLN| and another enriched in proline-, glutamic acid-, serine-, and CC GPRFLN| threonine-rich sequences CC GPRFLN| JOURNAL Mol. Cell. Biol. 12 (5), 2396-2405 (1992) CC GPRFLN| MEDLINE 92236615 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302143146| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 287 VNTIFKEY:269 FT PROTEIN 1 287 VNTIFKEY:270 FT REGION 20 287 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 287 AA; EILQQLLKEA QKKKLNSEEF ASEFLKLKRQ STKYKADKIY PTTVAQRPKN IKKNRYKDIL 60 PYDHSLVELS LLTSDEDSSY INASFIKGVY GPKAYIATQG PLSTTLLDFW RMIWEYRILV 120 IVMACMEFEM GKKKCERYWA EPGETQLQFG PFSISCEAEK KKSDYKIRTL KAKFNNETRI 180 IYQFHYKNWP DHDVPSSIDP ILQLIWDMRC YQEDDCVPIC IHCSAGCGRT GVICAVDYTW 240 MLLKDGIIPK NFSVFNLIQE MRTQRPSLVQ TQEQYELVYS AVLELFK 287 // ID mPEST_D1\(NP_035333)\Ptpn12 STANDARD;PRT; 288 AA. AC NP_035333; DT 4-JUL-2003 DE protein tyrosine phosphatase, non-receptor type 12 [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from X86781.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 775) CC GPRFLN| AUTHORS Charest,A., Wagner,J., Shen,S.H. and Tremblay,M.L. CC GPRFLN| TITLE Murine protein tyrosine phosphatase-PEST, a stable cytosolic CC GPRFLN| protein tyrosine phosphatase CC GPRFLN| JOURNAL Biochem. J. 308 (Pt 2), 425-432 (1995) CC GPRFLN| MEDLINE 95289971 CC GPRFLN|REFERENCE 2 (residues 1 to 775) CC GPRFLN| AUTHORS den Hertog,J., Pals,C.E., Jonk,L.J. and Kruijer,W. CC GPRFLN| TITLE Differential expression of a novel murine non-receptor protein CC GPRFLN| tyrosine phosphatase during differentiation of P19 embryonal CC GPRFLN| carcinoma cells CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 184 (3), 1241-1249 (1992) CC GPRFLN| MEDLINE 92272714 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302143076| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 288 VNTIFKEY:269 FT PROTEIN 1 288 VNTIFKEY:270 FT REGION 21 288 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 288 AA; RRFIQRVQAM KSPDHNGEDN FARDFMRLRR LSTKYRTEKI YPTATGEKEE NVKKNRYKDI 60 LPFDHSRVKL TLKTPSQDSD YINANFIKGV YGPKAYVATQ GPFRNTVIDF WRMIWEYNVV 120 MIVMACREFE MGRKKCERYW PLYGEDPITF APFKISCENE QARTDYFIRT LLLEFQNESR 180 RLYQFHYVNW PDHDVPSSFD SILDMISLMR KYQEHEDVPI CIHCSAGCGR TGAICAIDYT 240 WNLLKAGKIP EEFNVFNLIQ EMRTQRHSAV QTKEQYELVH RAIAQLFE 288 // ID mPTP1B_D1\(NP_035331)\Ptpn1 STANDARD;PRT; 279 AA. AC NP_035331; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 1 [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from U24700.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 432) CC GPRFLN| AUTHORS Haj,F.G., Markova,B., Klaman,L.D., Bohmer,F.D. and Neel,B.G. CC GPRFLN| TITLE Regulation of receptor tyrosine kinase signaling by protein CC GPRFLN| tyrosine phosphatase-1B CC GPRFLN| JOURNAL J. Biol. Chem. 278 (2), 739-744 (2003) CC GPRFLN| MEDLINE 22401841 CC GPRFLN| REMARK GeneRIF: Protein tyrosine phosphatase-1B regulates receptor CC GPRFLN| tyrosine kinase signaling. CC GPRFLN|REFERENCE 2 (residues 1 to 432) CC GPRFLN| AUTHORS Zinker,B.A., Rondinone,C.M., Trevillyan,J.M., Gum,R.J., CC GPRFLN| Clampit,J.E., Waring,J.F., Xie,N., Wilcox,D., Jacobson,P., CC GPRFLN| Frost,L., Kroeger,P.E., Reilly,R.M., Koterski,S., Opgenorth,T.J., CC GPRFLN| Ulrich,R.G., Crosby,S., Butler,M., Murray,S.F., McKay,R.A., CC GPRFLN| Bhanot,S., Monia,B.P. and Jirousek,M.R. CC GPRFLN| TITLE PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes CC GPRFLN| blood glucose, and improves insulin sensitivity in diabetic mice CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (17), 11357-11362 (2002) CC GPRFLN| MEDLINE 22177164 CC GPRFLN| REMARK GeneRIF: findings suggest that PTP1B modulates insulin signaling in CC GPRFLN| liver and fat, and that therapeutic modalities targeting PTP1B CC GPRFLN| inhibition may have clinical benefit in type 2 diabetes CC GPRFLN|REFERENCE 3 (residues 1 to 432) CC GPRFLN| AUTHORS Rondinone,C.M., Trevillyan,J.M., Clampit,J., Gum,R.J., Berg,C., CC GPRFLN| Kroeger,P., Frost,L., Zinker,B.A., Reilly,R., Ulrich,R., Butler,M., CC GPRFLN| Monia,B.P., Jirousek,M.R. and Waring,J.F. CC GPRFLN| TITLE Protein tyrosine phosphatase 1B reduction regulates adiposity and CC GPRFLN| expression of genes involved in lipogenesis CC GPRFLN| JOURNAL Diabetes 51 (8), 2405-2411 (2002) CC GPRFLN| MEDLINE 22139929 CC GPRFLN| REMARK GeneRIF: reduction regulates adiposity and expression of genes CC GPRFLN| involved in lipogenesis CC GPRFLN|REFERENCE 4 (residues 1 to 432) CC GPRFLN| AUTHORS Iversen,L.F., Moller,K.B., Pedersen,A.K., Peters,G.H., CC GPRFLN| Petersen,A.S., Andersen,H.S., Branner,S., Mortensen,S.B. and CC GPRFLN| Moller,N.P. CC GPRFLN| TITLE Structure determination of T cell protein-tyrosine phosphatase CC GPRFLN| JOURNAL J. Biol. Chem. 277 (22), 19982-19990 (2002) CC GPRFLN| MEDLINE 22028072 CC GPRFLN| REMARK GeneRIF: Structure determination of T cell protein-tyrosine CC GPRFLN| phosphatase CC GPRFLN|REFERENCE 5 (residues 1 to 432) CC GPRFLN| AUTHORS Cheng,A., Uetani,N., Simoncic,P.D., Chaubey,V.P., Lee-Loy,A., CC GPRFLN| McGlade,C.J., Kennedy,B.P. and Tremblay,M.L. CC GPRFLN| TITLE Attenuation of leptin action and regulation of obesity by protein CC GPRFLN| tyrosine phosphatase 1B CC GPRFLN| JOURNAL Dev. Cell 2 (4), 497-503 (2002) CC GPRFLN| MEDLINE 21966114 CC GPRFLN| REMARK GeneRIF: Attenuation of leptin action and regulation of obesity by CC GPRFLN| protein tyrosine phosphatase 1B. CC GPRFLN|REFERENCE 6 (residues 1 to 432) CC GPRFLN| AUTHORS Zabolotny,J.M., Bence-Hanulec,K.K., Stricker-Krongrad,A., Haj,F., CC GPRFLN| Wang,Y., Minokoshi,Y., Kim,Y.B., Elmquist,J.K., Tartaglia,L.A., CC GPRFLN| Kahn,B.B. and Neel,B.G. CC GPRFLN| TITLE PTP1B regulates leptin signal transduction in vivo CC GPRFLN| JOURNAL Dev. Cell 2 (4), 489-495 (2002) CC GPRFLN| MEDLINE 21966113 CC GPRFLN| REMARK GeneRIF: PTP1B regulates leptin signal transduction CC GPRFLN|REFERENCE 7 (residues 1 to 432) CC GPRFLN| AUTHORS Buckley,D.A., Cheng,A., Kiely,P.A., Tremblay,M.L. and O'Connor,R. CC GPRFLN| TITLE Regulation of insulin-like growth factor type I (IGF-I) receptor CC GPRFLN| kinase activity by protein tyrosine phosphatase 1B (PTP-1B) and CC GPRFLN| enhanced IGF-I-mediated suppression of apoptosis and motility in CC GPRFLN| PTP-1B-deficient fibroblasts CC GPRFLN| JOURNAL Mol. Cell. Biol. 22 (7), 1998-2010 (2002) CC GPRFLN| MEDLINE 21881935 CC GPRFLN| REMARK GeneRIF: Regulation of insulin-like growth factor type I (IGF-I) CC GPRFLN| receptor kinase activity by protein tyrosine phosphatase 1B CC GPRFLN| (PTP-1B) and enhanced IGF-I-mediated suppression of apoptosis and CC GPRFLN| motility in PTP-1B-deficient fibroblasts CC GPRFLN|REFERENCE 8 (residues 1 to 432) CC GPRFLN| AUTHORS Park,K.S., Kim,Y.W., Kim,C.W., Kang,D.O. and Byun,S.M. CC GPRFLN| TITLE Molecular cloning and expression of a cDNA encoding a protein CC GPRFLN| tyrosine phosphatase from mouse brain CC GPRFLN| JOURNAL Biochem. Mol. Biol. Int. 40 (5), 1025-1032 (1996) CC GPRFLN| MEDLINE 97114074 CC GPRFLN|REFERENCE 9 (residues 1 to 432) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 10 (residues 1 to 432) CC GPRFLN| AUTHORS Miyasaka,H. and Li,S.S. CC GPRFLN| TITLE The cDNA cloning, nucleotide sequence and expression of an CC GPRFLN| intracellular protein tyrosine phosphatase from mouse testis CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 185 (3), 818-825 (1992) CC GPRFLN| MEDLINE 92328784 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141893| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT REGION 3 279 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; MEMEKEFEEI DKAGNWAAIY QDIRHEASDF PCKVAKLPKN KNRNRYRDVS PFDHSRIKLH 60 QEDNDYINAS LIKMEEAQRS YILTQGPLPN TCGHFWEMVW EQKSRGVVML NRIMEKGSLK 120 CAQYWPQQEE KEMVFDDTGL KLTLISEDVK SYYTVRQLEL ENLTTKETRE ILHFHYTTWP 180 DFGVPESPAS FLNFLFKVRE SGSLSLEHGP IVVHCSAGIG RSGTFCLADT CLLLMDKRKD 240 PSSVDIKKVL LEMRRFRMGL IQTADQLRFS YLAVIEGAK 279 // ID mPTP36_D1\(NP_033002)\Ptpn14 STANDARD;PRT; 292 AA. AC NP_033002; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 14 [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from D31842.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1189) CC GPRFLN| AUTHORS Aoyama,K., Matsuda,T. and Aoki,N. CC GPRFLN| TITLE Characterization of newly identified four isoforms for a putative CC GPRFLN| cytosolic protein tyrosine phosphatase PTP36 CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 266 (2), 523-531 (1999) CC GPRFLN| MEDLINE 20068798 CC GPRFLN|REFERENCE 2 (residues 1 to 1189) CC GPRFLN| AUTHORS Sawada,M., Ogata,M., Fujino,Y. and Hamaoka,T. CC GPRFLN| TITLE cDNA cloning of a novel protein tyrosine phosphatase with homology CC GPRFLN| to cytoskeletal protein 4.1 and its expression in T-lineage cells CC GPRFLN| JOURNAL Biochem. Biophys. Res. Commun. 203 (1), 479-484 (1994) CC GPRFLN| MEDLINE 94354845 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302142963| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 292 VNTIFKEY:269 FT PROTEIN 1 292 VNTIFKEY:270 FT REGION 18 292 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 292 AA; VPIDERLRAL KKKLEDGMVF TEYEQIPNKK ANGVFSTATL PENAERSRIR EVVPYEENRV 60 ELIPTKENNT GYINASHIKV VVGGSEWHYI ATQGPLPHTC HDFWQMVWEQ GVNVIAMVTA 120 EEEGGRTKSH RYWPKLGSKH SSATYGKFKV TTKFRTDSGC YATTGLKVKH LLSGQERTVW 180 HLQYTDWPHH GCPEDVQGFL SYLEEIQSVR RHTNSVLEGI RTRHPPIVVH CSAGVGRTGV 240 VILSELMIYC LEHNEKVEVP TMLRFLREQR MFMIQTIAQY KFVYQVLVQF LQ 292 // ID mPTPalpha_D1\(AAK56109)\Ptpra STANDARD;PRT; 280 AA. AC AAK56109; DT 27-JUN-2003 DE protein tyrosin phosphatase receptor type alpha [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC Method: conceptual translation. CC GPRFLN|REFERENCE 1 (residues 1 to 793) CC GPRFLN| AUTHORS Ehringer,M.A., Thompson,J., Conroy,O., Xu,Y., Yang,F., Canniff,J., CC GPRFLN| Beeson,M., Gordon,L., Bennett,B., Johnson,T.E. and Sikela,J.M. CC GPRFLN| TITLE High-throughput sequence identification of gene coding variants CC GPRFLN| within alcohol-related QTLs CC GPRFLN| JOURNAL Mamm. Genome 12 (8), 657-663 (2001) CC GPRFLN| MEDLINE 21363810 CC GPRFLN|REFERENCE 2 (residues 1 to 793) CC GPRFLN| AUTHORS Ehringer,M.A., Thompson,J., Conroy,O., Xu,Y., Yang,F., Canniff,J., CC GPRFLN| Beeson,M., Gordon,L., Bennett,B., Johnson,T.E. and Sikela,J.M. CC GPRFLN| TITLE Direct Submission CC GPRFLN| JOURNAL Submitted (26-DEC-2000) Pharmacology, University of Colorado Health CC GPRFLN| Sciences Center, 4200 East Ninth Ave C236, Denver, CO 80262, USA CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306541430| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|UNKNOWN| FT SOURCE 1 280 VNTIFKEY:269 FT PROTEIN 1 280 VNTIFKEY:270 SQ SEQUENCE 280 AA; DKLEEEINRR MADDNKLFRE EFNALPACPI QATCEAASKE ENKEKNRYVN ILPYDHSRVH 60 LTPVEGVPDS DYINASFING YQEKNKFIAA QGPKEETVND FWRMIWEQNT ATIVMVTNLK 120 ERKECKCAQY WPDQGCWTYG NVRVSVEDVT VLVDYTVRKF CIQQVGDVTN RKPQRLITQF 180 HFTSWPDFGV PFTPIGMLKF LKKVKACNPQ YAGAIVVHCS AGVGRTGTFV VIDAMLDMMH 240 SERKVDVYGF VSRIRAQRCQ MVQTDMQYVF IYQALLEHYL 280 // ID mPTPalpha_D2\(NP_033006)\Ptpra STANDARD;PRT; 282 AA. AC NP_033006; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, A [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from M36033.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 829) CC GPRFLN| AUTHORS Zheng,X.M., Resnick,R.J. and Shalloway,D. CC GPRFLN| TITLE Mitotic activation of protein-tyrosine phosphatase alpha and CC GPRFLN| regulation of its Src-mediated transforming activity by its sites CC GPRFLN| of protein kinase C phosphorylation CC GPRFLN| JOURNAL J. Biol. Chem. 277 (24), 21922-21929 (2002) CC GPRFLN| MEDLINE 22050574 CC GPRFLN| REMARK GeneRIF: Mitotic activation of protein-tyrosine phosphatase alpha CC GPRFLN| and regulation of its Src-mediated transforming activity by its CC GPRFLN| sites of protein kinase C phosphorylation CC GPRFLN|REFERENCE 2 (residues 1 to 829) CC GPRFLN| AUTHORS Ehringer,M.A., Thompson,J., Conroy,O., Xu,Y., Yang,F., Canniff,J., CC GPRFLN| Beeson,M., Gordon,L., Bennett,B., Johnson,T.E. and Sikela,J.M. CC GPRFLN| TITLE High-throughput sequence identification of gene coding variants CC GPRFLN| within alcohol-related QTLs CC GPRFLN| JOURNAL Mamm. Genome 12 (8), 657-663 (2001) CC GPRFLN| MEDLINE 21363810 CC GPRFLN|REFERENCE 3 (residues 1 to 829) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 4 (residues 1 to 829) CC GPRFLN| AUTHORS Schepens,J., Zeeuwen,P., Wieringa,B. and Hendriks,W. CC GPRFLN| TITLE Identification and typing of members of the protein-tyrosine CC GPRFLN| phosphatase gene family expressed in mouse brain CC GPRFLN| JOURNAL Mol. Biol. Rep. 16 (4), 241-248 (1992) CC GPRFLN| MEDLINE 93086603 CC GPRFLN|REFERENCE 5 (residues 1 to 829) CC GPRFLN| AUTHORS Matthews,R.J., Cahir,E.D. and Thomas,M.L. CC GPRFLN| TITLE Identification of an additional member of the CC GPRFLN| protein-tyrosine-phosphatase family: evidence for alternative CC GPRFLN| splicing in the tyrosine phosphatase domain CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (12), 4444-4448 (1990) CC GPRFLN| MEDLINE 90280391 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141583| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 282 VNTIFKEY:269 FT PROTEIN 1 282 VNTIFKEY:270 FT CHAIN 1 282 VNTIFKEY:203; VNTINAME:Chain_1 FT REGION 21 281 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 282 AA; TSLETHLQKI YNKIPGTSNN GLEEEFKKLT SIKIQNDKMR TGNLPANMKK NRVLQIIPYE 60 FNRVIIPVKR GEENTDYVNA SFIDGYRQKD SYIASQGPLL HTIEDFWRMI WEWKSCSIVM 120 LTELEERGQE KCAQYWPSDG LVSYGDITVE LKKEEECESY TVRDLLVTNT RENKSRQIRQ 180 FHFHGWPEVG IPSDGKGMIN IIAAVQKQQQ QSGNHPITVH CSAGAGRTGT FCALSTVLER 240 VKAEGILDVF QTVKSLRLQR PHMVQTLEQY EFCYKVVQEY ID 282 // ID mPTPbeta_D1\(NP_084204)\Ptprb STANDARD;PRT; 280 AA. AC NP_084204; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, B; vascular endothelial protein tyrosine phosphatase [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from AY077755.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1998) CC GPRFLN| AUTHORS Nawroth,R., Poell,G., Ranft,A., Kloep,S., Samulowitz,U., CC GPRFLN| Fachinger,G., Golding,M., Shima,D.T., Deutsch,U. and Vestweber,D. CC GPRFLN| TITLE VE-PTP and VE-cadherin ectodomains interact to facilitate CC GPRFLN| regulation of phosphorylation and cell contacts CC GPRFLN| JOURNAL EMBO J. 21 (18), 4885-4895 (2002) CC GPRFLN| MEDLINE 22220060 CC GPRFLN| REMARK GeneRIF: Data show that vascular endothelial protein tyrosine CC GPRFLN| phosphatase (VE-PTP) is a transmembrane binding partner of CC GPRFLN| VE-cadherin that reduces the tyrosine phosphorylation of CC GPRFLN| VE-cadherin and cell layer permeability. CC GPRFLN|REFERENCE 2 (residues 1 to 1998) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 3 (residues 1 to 1998) CC GPRFLN| AUTHORS Schepens,J., Zeeuwen,P., Wieringa,B. and Hendriks,W. CC GPRFLN| TITLE Identification and typing of members of the protein-tyrosine CC GPRFLN| phosphatase gene family expressed in mouse brain CC GPRFLN| JOURNAL Mol. Biol. Rep. 16 (4), 241-248 (1992) CC GPRFLN| MEDLINE 93086603 CC GPRFLN|REFERENCE 4 (residues 1 to 1998) CC GPRFLN| AUTHORS Gebbink,M.F., van Etten,I., Hateboer,G., Suijkerbuijk,R., CC GPRFLN| Beijersbergen,R.L., Geurts van Kessel,A. and Moolenaar,W.H. CC GPRFLN| TITLE Cloning, expression and chromosomal localization of a new putative CC GPRFLN| receptor-like protein tyrosine phosphatase CC GPRFLN| JOURNAL FEBS Lett. 290 (1-2), 123-130 (1991) CC GPRFLN| MEDLINE 92008644 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302133158| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 280 VNTIFKEY:269 FT PROTEIN 1 280 vascular endothelial protein tyrosine phosphatase FT VNTIFKEY:270 FT REGION 17 280 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 280 AA; NQFEGHFMKL QADSNYLLSK EYEDLKDVGR SQSCDIALLP ENRGKNRYNN ILPYDASRVK 60 LSNVDDDPCS DYINASYIPG NNFRREYIAT QGPLPGTKDD FWKMAWEQNV HNIVMVTQCV 120 EKGRVKCDHY WPADQDPLYY GDLILQMVSE SVLPEWTIRE FKICSEEQLD AHRLIRHFHY 180 TVWPDHGVPE TTQSLIQFVR TVRDYINRSP GAGPTVVHCS AGVGRTGTFV ALDRILQQLD 240 SKDSVDIYGA VHDLRLHRVH MVQTECQYVY LHQCVRDVLR 280 // ID mPTPBL_D1\(NP_035334)\Ptpn13 STANDARD;PRT; 275 AA. AC NP_035334; DT 17-MAY-2003 DE protein tyrosine phosphatase, non-receptor type 13 [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from Z32740.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 2460) CC GPRFLN| AUTHORS Palmer,A., Zimmer,M., Erdmann,K.S., Eulenburg,V., Porthin,A., CC GPRFLN| Heumann,R., Deutsch,U. and Klein,R. CC GPRFLN| TITLE EphrinB phosphorylation and reverse signaling: regulation by Src CC GPRFLN| kinases and PTP-BL phosphatase CC GPRFLN| JOURNAL Mol. Cell 9 (4), 725-737 (2002) CC GPRFLN| MEDLINE 21980164 CC GPRFLN| REMARK GeneRIF: With delayed kinetics, ephrinB ligands recruit the CC GPRFLN| cytoplasmic PDZ domain containing protein tyrosine phosphatase CC GPRFLN| PTP-BL and are dephosphorylated. CC GPRFLN|REFERENCE 2 (residues 1 to 2460) CC GPRFLN| AUTHORS Walma,T., Spronk,C.A., Tessari,M., Aelen,J., Schepens,J., CC GPRFLN| Hendriks,W. and Vuister,G.W. CC GPRFLN| TITLE Structure, dynamics and binding characteristics of the second PDZ CC GPRFLN| domain of PTP-BL CC GPRFLN| JOURNAL J. Mol. Biol. 316 (5), 1101-1110 (2002) CC GPRFLN| MEDLINE 21881810 CC GPRFLN| REMARK GeneRIF: Structure, dynamics and binding characteristics of the CC GPRFLN| second PDZ domain of PTP-BL CC GPRFLN|REFERENCE 3 (residues 1 to 2460) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Bachner,D., Rijss,J., Zeeuwen,P., CC GPRFLN| Zechner,U., Hameister,H. and Wieringa,B. CC GPRFLN| TITLE Molecular cloning of a mouse epithelial protein-tyrosine CC GPRFLN| phosphatase with similarities to submembranous proteins CC GPRFLN| JOURNAL J. Cell. Biochem. 59 (4), 418-430 (1995) CC GPRFLN| MEDLINE 96340953 CC GPRFLN|REFERENCE 4 (residues 1 to 2460) CC GPRFLN| AUTHORS Chida,D., Kume,T., Mukouyama,Y., Tabata,S., Nomura,N., Thomas,M.L., CC GPRFLN| Watanabe,T. and Oishi,M. CC GPRFLN| TITLE Characterization of a protein tyrosine phosphatase (RIP) expressed CC GPRFLN| at a very early stage of differentiation in both mouse CC GPRFLN| erythroleukemia and embryonal carcinoma cells CC GPRFLN| JOURNAL FEBS Lett. 358 (3), 233-239 (1995) CC GPRFLN| MEDLINE 95145716 CC GPRFLN|REFERENCE 5 (residues 1 to 2460) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302143017| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 275 VNTIFKEY:269 FT PROTEIN 1 275 VNTIFKEY:270 FT REGION 20 274 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 275 AA; TQLQATIRTL QGLLDQGIPS KELENLQELK PLDQCLIGQT KENRRKNRYK NILPYDTTRV 60 PLGDEGGYIN ASFIRIPVGT QEFVYIACQG PLPTTVGDFW QMVWEQNSTV IAMMTQEVEG 120 EKIKCQRYWP SILGTTTMAN ERLRLALLRM QQLKGFIVRV MALEDIQTGE VRHISHLNFT 180 AWPDHDTPSQ PDDLLTFISY MRHIRRSGPV ITHCSAGIGR SGTLICIDVV LGLISQDLEF 240 DISDLVRCMR LQRHGMVQTE GQYVFCYQVI LYVLT 275 // ID mPTPdelta_D1\(D54689)\Ptprd STANDARD;PRT; 273 AA. AC D54689; DT 17-MAY-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48), receptor type delta, splice form D precursor - mouse. KW alternative splicing; glycoprotein; phosphoprotein; phosphoric monoester hydrolase; transmembrane protein; tyrosine-specific phosphatase. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC GPRFLN|REFERENCE 1 (residues 1 to 1691) CC GPRFLN| AUTHORS Mizuno,K., Hasegawa,K., Katagiri,T., Ogimoto,M., Ichikawa,T. and CC GPRFLN| Yakura,H. CC GPRFLN| TITLE MPTP delta, a putative murine homolog of HPTP delta, is expressed CC GPRFLN| in specialized regions of the brain and in the B-cell lineage CC GPRFLN| JOURNAL Mol. Cell. Biol. 13 (9), 5513-5523 (1993) CC GPRFLN| MEDLINE 93360986 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302132575| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 273 VNTIFKEY:269 FT PROTEIN 1 273 MPTP delta type D FT VNTIFKEY:270 FT DOMAIN 1 273 leukocyte common antigen cytosolic domain homology #label LAC FT VNTIFKEY:1000; VNTINAME:LAC FT ACT_SITE 212 212 Cys (phosphocysteine intermediate) FT VNTIFKEY:220; VNTINAME:Active_Site_1 FT BINDING 218 218 substrate phosphate (Arg) FT VNTIFKEY:1007; VNTINAME:Binding_1 SQ SEQUENCE 273 AA; LELADHIERL KANDNLKFSQ EYESIDPGQQ FTWEHSNLEV NKPKNRYANV IAYDHSRVLL 60 SAIEGIPGSD YVNANYIDGY RKQNAYIATQ GSLPETFGDF WRMIWEQEAT VVMMTKLEER 120 SRVKCDQYWP SRGTETHGLV QVTLLDTVEL TYCVRTFALY NNGSSEKRKV RQFQFTAWPD 180 HGVPEHPTPF LAFLRRVKTC NPPDAGPMVV HCSAGVGRTG CFIVIDAMLE RIKHEKTVDI 240 YGHVTLMRAQ RNYMVQTEDQ YIFIHDALLE AVT 273 // ID mPTPdelta_D2\(D54689)\Ptprd STANDARD;PRT; 282 AA. AC D54689; DT 17-MAY-2003 DE protein-tyrosine-phosphatase (EC 3.1.3.48), receptor type delta, splice form D precursor - mouse. KW alternative splicing; glycoprotein; phosphoprotein; phosphoric monoester hydrolase; transmembrane protein; tyrosine-specific phosphatase. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC GPRFLN|REFERENCE 1 (residues 1 to 1691) CC GPRFLN| AUTHORS Mizuno,K., Hasegawa,K., Katagiri,T., Ogimoto,M., Ichikawa,T. and CC GPRFLN| Yakura,H. CC GPRFLN| TITLE MPTP delta, a putative murine homolog of HPTP delta, is expressed CC GPRFLN| in specialized regions of the brain and in the B-cell lineage CC GPRFLN| JOURNAL Mol. Cell. Biol. 13 (9), 5513-5523 (1993) CC GPRFLN| MEDLINE 93360986 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141689| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 282 VNTIFKEY:269 FT PROTEIN 1 282 MPTP delta type D FT VNTIFKEY:270 FT DOMAIN 1 282 leukocyte common antigen cytosolic domain homology #label LAC FT VNTIFKEY:1000; VNTINAME:LAC FT DOMAIN 47 269 protein-tyrosine-phosphatase homology #label PTP2 FT VNTIFKEY:1000; VNTINAME:PTP2 FT ACT_SITE 221 221 Cys (phosphocysteine intermediate) FT VNTIFKEY:220; VNTINAME:Active_Site_2 FT BINDING 227 227 substrate phosphate (Arg) FT VNTIFKEY:1007; VNTINAME:Binding_2 SQ SEQUENCE 282 AA; RNLYAYIQKL TQIETGENVT GMELEFKRLA SSKAHTSRFI SANLPCNKFK NRLVNIMPYE 60 SGRVCLQPIR GVEGSDYINA SFLDGYRQQK AYIATQGPLA ETTEDFWRML WEHNSTIVVM 120 LTKLREMGRE KCHQYWPAER SARYQYFVVD PMAEYNMPQY ILREFKVTDA RDQSRTVRQF 180 QFTDWPEQGV PKSGEGFIDF IGQVHKTKEQ FGQDGPISVH CSAGVGRTGV FITLSIVLER 240 MRYEGVVDIF QTVKMLRTQR PAMVQTEDQY QFCYRAALEY LG 282 // ID mPTPepsilon_D1\(NP_035342)\Ptpre STANDARD;PRT; 279 AA. AC NP_035342; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, E [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from U62387.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 699) CC GPRFLN| AUTHORS Schmidt,A., Rutledge,S.J., Endo,N., Opas,E.E., Tanaka,H., CC GPRFLN| Wesolowski,G., Leu,C.T., Huang,Z., Ramachandaran,C., Rodan,S.B. and CC GPRFLN| Rodan,G.A. CC GPRFLN| TITLE Protein-tyrosine phosphatase activity regulates osteoclast CC GPRFLN| formation and function: inhibition by alendronate CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (7), 3068-3073 (1996) CC GPRFLN| MEDLINE 96181534 CC GPRFLN|REFERENCE 2 (residues 1 to 699) CC GPRFLN| AUTHORS Elson,A. and Leder,P. CC GPRFLN| TITLE Identification of a cytoplasmic, phorbol ester-inducible isoform of CC GPRFLN| protein tyrosine phosphatase epsilon CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (26), 12235-12239 (1995) CC GPRFLN| MEDLINE 96109240 CC GPRFLN|REFERENCE 3 (residues 1 to 699) CC GPRFLN| AUTHORS Elson,A. and Leder,P. CC GPRFLN| TITLE Protein-tyrosine phosphatase epsilon. An isoform specifically CC GPRFLN| expressed in mouse mammary tumors initiated by v-Ha-ras OR neu CC GPRFLN| JOURNAL J. Biol. Chem. 270 (44), 26116-26122 (1995) CC GPRFLN| MEDLINE 96064677 CC GPRFLN|REFERENCE 4 (residues 1 to 699) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 5 (residues 1 to 699) CC GPRFLN| AUTHORS Schepens,J., Zeeuwen,P., Wieringa,B. and Hendriks,W. CC GPRFLN| TITLE Identification and typing of members of the protein-tyrosine CC GPRFLN| phosphatase gene family expressed in mouse brain CC GPRFLN| JOURNAL Mol. Biol. Rep. 16 (4), 241-248 (1992) CC GPRFLN| MEDLINE 93086603 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302142852| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 VNTIFKEY:270 FT REGION 18 279 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; EHLEEEIRVR SADDCKRFRE EFNSLPSGHI QGTFELANKE ENREKNRYPN ILPNDHCRVI 60 LSQVDGIPCS DYINASYIDG YKEKNKFIAA QGPKQETVND FWRMVWEQRS ATIVMLTNLK 120 ERKEEKCYQY WPDQGCWTYG NIRVCVEDCV VLVDYTIRKF CIHPQLPDSC KAPRLVSQLH 180 FTSWPDFGVP FTPIGMLKFL KKVKTLNPSH AGPIVVHCSA GVGRTGTFIV IDAMMDMIHS 240 EQKVDVFEFV SRIRNQRPQM VQTDVQYTFI YQALLEYYL 279 // ID mPTPepsilon_D2\(NP_035342)\Ptpre STANDARD;PRT; 287 AA. AC NP_035342; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, E [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from U62387.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 699) CC GPRFLN| AUTHORS Schmidt,A., Rutledge,S.J., Endo,N., Opas,E.E., Tanaka,H., CC GPRFLN| Wesolowski,G., Leu,C.T., Huang,Z., Ramachandaran,C., Rodan,S.B. and CC GPRFLN| Rodan,G.A. CC GPRFLN| TITLE Protein-tyrosine phosphatase activity regulates osteoclast CC GPRFLN| formation and function: inhibition by alendronate CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (7), 3068-3073 (1996) CC GPRFLN| MEDLINE 96181534 CC GPRFLN|REFERENCE 2 (residues 1 to 699) CC GPRFLN| AUTHORS Elson,A. and Leder,P. CC GPRFLN| TITLE Identification of a cytoplasmic, phorbol ester-inducible isoform of CC GPRFLN| protein tyrosine phosphatase epsilon CC GPRFLN| JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (26), 12235-12239 (1995) CC GPRFLN| MEDLINE 96109240 CC GPRFLN|REFERENCE 3 (residues 1 to 699) CC GPRFLN| AUTHORS Elson,A. and Leder,P. CC GPRFLN| TITLE Protein-tyrosine phosphatase epsilon. An isoform specifically CC GPRFLN| expressed in mouse mammary tumors initiated by v-Ha-ras OR neu CC GPRFLN| JOURNAL J. Biol. Chem. 270 (44), 26116-26122 (1995) CC GPRFLN| MEDLINE 96064677 CC GPRFLN|REFERENCE 4 (residues 1 to 699) CC GPRFLN| AUTHORS Hendriks,W., Schepens,J., Brugman,C., Zeeuwen,P. and Wieringa,B. CC GPRFLN| TITLE A novel receptor-type protein tyrosine phosphatase with a single CC GPRFLN| catalytic domain is specifically expressed in mouse brain CC GPRFLN| JOURNAL Biochem. J. 305 (Pt 2), 499-504 (1995) CC GPRFLN| MEDLINE 95134232 CC GPRFLN|REFERENCE 5 (residues 1 to 699) CC GPRFLN| AUTHORS Schepens,J., Zeeuwen,P., Wieringa,B. and Hendriks,W. CC GPRFLN| TITLE Identification and typing of members of the protein-tyrosine CC GPRFLN| phosphatase gene family expressed in mouse brain CC GPRFLN| JOURNAL Mol. Biol. Rep. 16 (4), 241-248 (1992) CC GPRFLN| MEDLINE 93086603 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302141497| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 287 VNTIFKEY:269 FT PROTEIN 1 287 VNTIFKEY:270 FT REGION 21 286 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 287 AA; SSLERHLQTL HSTATHFDKI GLEEEFRKLT NVRIMKENMR TGNLPANMKK ARVIQIIPYD 60 FNRVILSMKR GQEFTDYINA SFIDGYRQKD YFMATQGPLA HTGEDFWRMV WEWKSHTIVM 120 LTEVQEREQD KCYQYWPTEG SVTHGDITIE IKSDTLSEAI SVRDFLVTFK QPLARQEEQV 180 RMVRQFHFHG WPEVGIPAEG KGMIDLIAAV QKQQQQTGNH PITVHCSAGA GRTGTFIALS 240 NILERVKAEG LLDVFQAVKS LRLQRPHMVQ TLEQYEFCYK VVQDFID 287 // ID mPTPESP_D1\(NP_031981)\Ptprv STANDARD;PRT; 279 AA. AC NP_031981; DT 17-MAY-2003 DE embryonic stem cell phosphatase; protein tyrosine phosphatase, receptor type, W [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from U36488.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1705) CC GPRFLN| AUTHORS Morrison,D.F. and Mauro,L.J. CC GPRFLN| TITLE Structural characterization and chromosomal localization of the CC GPRFLN| mouse cDNA and gene encoding the bone tyrosine phosphatase, CC GPRFLN| mOST-PTP CC GPRFLN| JOURNAL Gene 257 (2), 195-208 (2000) CC GPRFLN| MEDLINE 20534790 CC GPRFLN|REFERENCE 2 (residues 1 to 1705) CC GPRFLN| AUTHORS Lee,K., Nichols,J. and Smith,A. CC GPRFLN| TITLE Identification of a developmentally regulated protein tyrosine CC GPRFLN| phosphatase in embryonic stem cells that is a marker of CC GPRFLN| pluripotential epiblast and early mesoderm CC GPRFLN| JOURNAL Mech. Dev. 59 (2), 153-164 (1996) CC GPRFLN| MEDLINE 97109513 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302133369| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 279 VNTIFKEY:269 FT PROTEIN 1 279 protein tyrosine phosphatase, receptor type, W FT VNTIFKEY:270 FT PROTEIN 1 279 putative; protein tyrosine phosphatase, receptor type, W FT VNTIFKEY:270 FT REGION 18 279 PTPc FT VNTIFKEY:266; VNTINAME:Region_1 SQ SEQUENCE 279 AA; HSFRQSYEAK SARAHQAFFQ EFEELKEVGK DQPRLEAEHP ANITKNRYPH VLPYDHSRVR 60 LTQLSGEPHS DYINANFIPG YSHPQEIIAT QGPLKKTVED FWRLVWEQQV HVIIMLTVGM 120 ENGRVLCEHY WPVNSTPVTH GHITTHLLAE ESEDEWTRRE FQLQHGAEQK QRRVKQLQFT 180 TWPDHSVPEA PSSLLAFVEL VQEEVKATQG KGPILVHCSA GVGRTGTFVA LLPAVRQLEE 240 EQVVDVFNTV YILRLHRPLM IQTLSQYIFL HSCLLNKIL 279 // ID mPTPESP_D2\(NP_031981)\Ptprv STANDARD;PRT; 278 AA. AC NP_031981; DT 30-JUN-2003 DE embryonic stem cell phosphatase; protein tyrosine phosphatase, receptor type, W [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from U36488.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1705) CC GPRFLN| AUTHORS Morrison,D.F. and Mauro,L.J. CC GPRFLN| TITLE Structural characterization and chromosomal localization of the CC GPRFLN| mouse cDNA and gene encoding the bone tyrosine phosphatase, CC GPRFLN| mOST-PTP CC GPRFLN| JOURNAL Gene 257 (2), 195-208 (2000) CC GPRFLN| MEDLINE 20534790 CC GPRFLN|REFERENCE 2 (residues 1 to 1705) CC GPRFLN| AUTHORS Lee,K., Nichols,J. and Smith,A. CC GPRFLN| TITLE Identification of a developmentally regulated protein tyrosine CC GPRFLN| phosphatase in embryonic stem cells that is a marker of CC GPRFLN| pluripotential epiblast and early mesoderm CC GPRFLN| JOURNAL Mech. Dev. 59 (2), 153-164 (1996) CC GPRFLN| MEDLINE 97109513 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|306759656| CC VNTAUTHORNAME|JNA| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 278 VNTIFKEY:269 FT PROTEIN 1 278 protein tyrosine phosphatase, receptor type, W FT VNTIFKEY:270 FT PROTEIN 1 278 putative; protein tyrosine phosphatase, receptor type, W FT VNTIFKEY:270 FT REGION 67 278 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 278 AA; SGPIPVMNFA QACAKRAANA NAGFLKEYRL LKQAIKDETG SLLPSPDYNQ NSIASCHHSQ 60 EQLALVEESP ADNMLAASLF PGGPSGRDHV VLTGSAGPKE LWEMVWEHGA YVLVSLGLPD 120 TKEKPQDIWP MEMQPIVTDM VTVHRVAESN TAGWPSTLIR VIHGDSGTER QVQCLQFPHC 180 ETGSELPANT LLTFLDAVGQ CCSRGNSKKP GTLLSHSSKV TNQLSTFLAM EQLLQQAGTE 240 RTVDVFSVAL KQTQACAVKT PTLEQYIYLY NCLNSALR 278 // ID mPTPgamma_D1\(NP_033007)\Ptprg STANDARD;PRT; 291 AA. AC NP_033007; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, G [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from L09562.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1442) CC GPRFLN| AUTHORS Barnea,G., Silvennoinen,O., Shaanan,B., Honegger,A.M., Canoll,P.D., CC GPRFLN| D'Eustachio,P., Morse,B., Levy,J.B., Laforgia,S., Huebner,K. et al. CC GPRFLN| TITLE Identification of a carbonic anhydrase-like domain in the CC GPRFLN| extracellular region of RPTP gamma defines a new subfamily of CC GPRFLN| receptor tyrosine phosphatases CC GPRFLN| JOURNAL Mol. Cell. Biol. 13 (3), 1497-1506 (1993) CC GPRFLN| MEDLINE 93180796 CC This file is created by Vector NTI suite CC ORIGDB|GenPept CC VNTDATE|302132875| CC VNTAUTHORNAME|Jannik N Andersen| CC VNTAUTHOREML|jannik@noergaardandersen.com| CC VNTAUTHORWWW|http://ptp.cshl.edu & http://science.novonordisk.com/ptp| CC VNTOAUTHORNAME|NCBI Entrez| CC VNTOAUTHORTEL|(301)496-2475| CC VNTOAUTHORFAX|(301)480-9241| CC VNTOAUTHOREML|info@ncbi.nlm.nih.gov| CC VNTOAUTHORWWW|http://www3.ncbi.nlm.nih.gov/Entrez/| CC VNTOAUTHORAD1|National Center for Biotechnology Information| CC VNTOAUTHORAD2|National Library of Medicine| CC VNTOAUTHORAD3|Building 38A, Room 8N805| CC VNTOAUTHORAD4|Bethesda, MD 20894, U.S.A.| FT SOURCE 1 291 VNTIFKEY:269 FT PROTEIN 1 291 VNTIFKEY:270 FT REGION 17 291 PTPc FT VNTIFKEY:266; VNTINAME:Region_2 SQ SEQUENCE 291 AA; KQFGKHIGEL YSNSQHGFSE DFEEVQRCTA DMNITAEHSN HPDNKHKNRY INILAYDHSR 60 VKLRPLPGKD SKHSDYINAN YVDGYNKAKA YIATQGPLKS TFEDFWRMIW EQNTGIIIMI 120 TNLVEKGRRK CDQYWPTENT EEYGNIIVTL KSTKVHACYT VRRLSVRNTK VKKGQKGNPK 180 GRQNERTVIQ YHYTQWPDMG VPEYALPVLT FVRRSSAARM PDMGPVLVHC SAGVGRTGTY 240 IVIDSMLQQI KDKSTVNVLG FLKHIRTQRN YLVQTEEQYI FIHDALLEAI L 291 // ID mPTPgamma_D2\(NP_033007)\Ptprg STANDARD;PRT; 283 AA. AC NP_033007; DT 17-MAY-2003 DE protein tyrosine phosphatase, receptor type, G [Mus musculus]. OS Mus musculus. OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Rodentia; Sciurognathi; Muridae; Murinae; Mus. CC PROVISIONAL REFSEQ: This record has not yet been subject to final CC NCBI review. The reference sequence was derived from L09562.1. CC CC GPRFLN|REFERENCE 1 (residues 1 to 1442) CC GPRFLN| AUTHORS Barnea,G., Silvennoinen,O., Shaanan,B., Honegger,A.M., Canoll,P.D., CC GPRFLN| D'Eustachio,P., Morse,B., Levy,J.B., Laforgia,S., Huebner,K. et al. CC GPRFLN| TITLE Identification of a carbonic anhydrase-like domain in the CC GPRFLN| extracellular region of RPTP gamma defines a new subfamily of CC GPRFLN| receptor tyrosine phosphatases CC GPRFLN| JOU